Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 36% [===================                               ] \                     
 42% [======================                            ] |                     
 48% [=========================                         ] /                     
 54% [============================                      ] -                     
 60% [===============================                   ] \                     
 67% [==================================                ] |                     
 73% [=====================================             ] /                     
 79% [========================================          ] -                     
 85% [===========================================       ] \                     
 91% [==============================================    ] |                     
 97% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/0077c599-73c9-40b2-8512-ff4b13811898/final_image/TGOLN2_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.61 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.61 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.61 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.23 MB
Based on canonical annotations, the following gene is in your area of interest: TGOLN2(-)
write fasta - Elapsed time since the previous call: 0.76 seconds
write fasta - Current memory usage: 170.23 MB
Length of region: 82 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 173.45 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/0077c599-73c9-40b2-8512-ff4b13811898/fasta/TGOLN2.fasta" "/disk1/www/rails/humanrnamap/public/result/0077c599-73c9-40b2-8512-ff4b13811898/ct/TGOLN2.ct" --SHAPE "TGOLN2.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 173.45 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/0077c599-73c9-40b2-8512-ff4b13811898/ct/TGOLN2.ct" "/disk1/www/rails/humanrnamap/public/result/0077c599-73c9-40b2-8512-ff4b13811898/fold_FE/TGOLN2.txt" -sh "TGOLN2.dat"

efn2 - Elapsed time since the previous call: 0.39 seconds
efn2 - Current memory usage: 173.45 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/0077c599-73c9-40b2-8512-ff4b13811898/ct/TGOLN2.ct" 1 "/disk1/www/rails/humanrnamap/public/result/0077c599-73c9-40b2-8512-ff4b13811898/fold_dbn/TGOLN2_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.45 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGCAAGUCGGGUUCGGAGGCGCAGACCACAAAAGACAGCACUAGUAAGUCGCAUCCGGAGCUGCAGACUCCAAAAGACAGCA', '-structureDBN', '....((((((.((((((.((((..((.................))..).))).)))))).))...)))).............', '-o', '/disk1/www/rails/humanrnamap/public/result/0077c599-73c9-40b2-8512-ff4b13811898/final_image/TGOLN2_fold_1.svg', '-title', 'TGOLN2, -19.2 ± 1.1\n kcal/mol, AUC: 0.676', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,6,7,9,10,11,12,13,15,16,18,19,21,24,34,38,42,44,45,48,49,51,54,57,58,60,62,63,66,69,76,80', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '33,68,72,50,82,20,52,53,55,56,59,31', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '32,35,67,8,73,14,17,81,28', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,65,3,4,5,70,71,74,75,77,78,79,22,23,25,26,27,29,30,36,37,39,40,41,43,46,47,61']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 328.7841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 346.2841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 363.7841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 381.2841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 398.7841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 398.7841814372966, Y: 270.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 398.7841814372966, Y: 250.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 398.7841814372966, Y: 230.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 389.9870646717595, Y: 215.0771646454177, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 372.604561598982, Y: 205.18532018015844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 355.24295753108925, Y: 202.98939109456515, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 344.48745188840826, Y: 189.18480856811829, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 327.10491414775134, Y: 179.2930250234466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 309.7223764070944, Y: 169.40124147877492, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 292.33983866643746, Y: 159.50945793410324, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 274.95730092578054, Y: 149.61767438943156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 257.57476318512363, Y: 139.72589084475987, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 240.21315142125616, Y: 137.53002260646207, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 229.45759739766663, Y: 123.72547777496288, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.07502498934377, Y: 113.83375515100028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.69245258102092, Y: 103.94203252703772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.18566403147997, Y: 99.83881433635094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 165.09622481034887, Y: 110.21849765375265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 147.596221286478, Y: 110.21849765375265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 133.5067820653469, Y: 99.83881433635094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 113.5067820653469, Y: 99.83881433635094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 105.82104660707819, Y: 115.5607831216526, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 93.6286586821551, Y: 128.11452792982362, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 78.13780837801403, Y: 136.25605044561763, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 60.8835429633823, Y: 139.17857624053119, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 43.57565321659786, Y: 136.5925011191079, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 27.929243755006155, Y: 128.75408910003785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 15.494776795841972, Y: 116.44007823996702, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 7.504430958676721, Y: 100.87071070551059, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 83.58881433635094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 7.504430958676721, Y: 66.30691796719128, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 15.494776795841972, Y: 50.737550432734736, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 27.929243755006155, Y: 38.42353957266397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 43.57565321659786, Y: 30.585127553593793, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 60.8835429633823, Y: 27.999052432170515, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 78.13780837801391, Y: 30.921578227084183, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 93.6286586821551, Y: 39.063100742878134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 105.82104660707819, Y: 51.61684555104921, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 113.5067820653469, Y: 67.33881433635094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 133.5067820653469, Y: 67.33881433635094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 147.596221286478, Y: 56.95913101894911, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 165.09622481034887, Y: 56.95913101894911, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.18566403147997, Y: 67.33881433635094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.0412114161088, Y: 63.71259693316273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 210.76650184496015, Y: 75.69535236351311, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 228.14907425328295, Y: 85.58707498747566, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 245.5316466616058, Y: 95.47879761143827, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.893335961954, Y: 97.6746447459571, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 273.64891144521505, Y: 111.47926701619235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 291.031449185872, Y: 121.37105056086403, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 308.41398692652893, Y: 131.26283410553572, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 325.79652466718585, Y: 141.1546176502074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 343.1790624078428, Y: 151.04640119487908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 360.56160014849974, Y: 160.93818473955076, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 377.9232817529472, Y: 163.13409272163688, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 388.6788088550283, Y: 176.938752686895, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 406.06131192780583, Y: 186.8305971521542, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 423.5605475266097, Y: 186.6670323101049, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 437.0245624924159, Y: 197.8460439390704, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 440.08132559598744, Y: 215.07701023027542, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 431.2841814372966, Y: 230.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 431.2841814372966, Y: 250.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 431.2841814372966, Y: 270.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 431.2841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 448.7841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 466.2841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 483.7841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 501.28418143729664, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 518.7841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 536.2841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 553.7841814372966, Y: 290.2051381597719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 571.2841814372966, Y: 290.20513815977193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 588.7841814372966, Y: 290.20513815977193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 606.2841814372966, Y: 290.20513815977193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 623.7841814372966, Y: 290.20513815977193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 641.2841814372966, Y: 290.20513815977193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 658.7841814372966, Y: 290.20513815977193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 329.5341814372966, Y: 310.2051381597719, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 352.5133734941428, Y: 216.7163900057324, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 198.4333023653812, Y: 131.21632755932313, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 57.328226848937106, Y: 159.1776286727017, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 57.328226848937106, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 214.58360913540827, Y: 57.18214390968626, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 384.06509575792785, Y: 145.75157231489297, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 445.0341814372966, Y: 310.2051381597719, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 620.0341814372966, Y: 310.20513815977193, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '82', X: 655.0341814372966, Y: 310.20513815977193, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TGOLN2, -19.2 ± 1.1
 kcal/mol, AUC: 0.676', X: 265.7670907186483, Y: 323.00513815977195, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 673.0341814372966, 323.00513815977195)
Updated viewBox: -0.25 -5.0 678.2841814372966 333.00513815977195
Updated SVG: /disk1/www/rails/humanrnamap/public/result/0077c599-73c9-40b2-8512-ff4b13811898/final_image/TGOLN2_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/0077c599-73c9-40b2-8512-ff4b13811898/final_image/TGOLN2_fold_final_1.svg
