Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 36% [===================                               ] \                     
 42% [======================                            ] |                     
 48% [=========================                         ] /                     
 54% [============================                      ] -                     
 60% [===============================                   ] \                     
 66% [==================================                ] |                     
 72% [=====================================             ] /                     
 78% [========================================          ] -                     
 84% [===========================================       ] \                     
 90% [==============================================    ] |                     
 96% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/01b7cd35-4705-4399-b9d2-511da5fdd673/final_image/BRCA1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.65 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.65 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.65 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.34 MB
Based on canonical annotations, the following gene is in your area of interest: BRCA1(-)
write fasta - Elapsed time since the previous call: 0.68 seconds
write fasta - Current memory usage: 172.34 MB
Length of region: 83 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.26 seconds
write dat - Current memory usage: 175.88 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/01b7cd35-4705-4399-b9d2-511da5fdd673/fasta/BRCA1.fasta" "/disk1/www/rails/humanrnamap/public/result/01b7cd35-4705-4399-b9d2-511da5fdd673/ct/BRCA1.ct" --SHAPE "BRCA1.dat"

fold - Elapsed time since the previous call: 0.12 seconds
fold - Current memory usage: 175.88 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/01b7cd35-4705-4399-b9d2-511da5fdd673/ct/BRCA1.ct" "/disk1/www/rails/humanrnamap/public/result/01b7cd35-4705-4399-b9d2-511da5fdd673/fold_FE/BRCA1.txt" -sh "BRCA1.dat"

efn2 - Elapsed time since the previous call: 0.55 seconds
efn2 - Current memory usage: 175.88 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/01b7cd35-4705-4399-b9d2-511da5fdd673/ct/BRCA1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/01b7cd35-4705-4399-b9d2-511da5fdd673/fold_dbn/BRCA1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 175.88 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AACAUUCCAAGUACAGUGAGCACAAUUAGCCGUAAUAACAUUAGAGAAAAUGUUUUUAAAGAAGCCAGCUCAAGCAAUAUUAA', '-structureDBN', '................(((((....((.....(((.((((((......)))))).)))...))....)))))...........', '-o', '/disk1/www/rails/humanrnamap/public/result/01b7cd35-4705-4399-b9d2-511da5fdd673/final_image/BRCA1_fold_1.svg', '-title', 'BRCA1, -8.9 ± 0.7\n kcal/mol, AUC: 0.678', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,6,11,12,16,17,18,20,26,27,29,32,33,36,41,42,44,46,51,52,53,54,55,56,57,61,64,68,70,74,78,80,81', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '48,66,58,62,63', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,2,3,65,69,7,8,71,76,15,82,19,21,22,24,28,37,38,40,43,50,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '67,4,72,9,10,73,75,13,14,77,79,83,23,25,30,31,34,35,39,45,47,49,59']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 448.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.25, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.75, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 284.75, Y: 428.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.75, Y: 408.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 284.75, Y: 388.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.75, Y: 368.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 270.9269188260254, Y: 357.29760910728373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 263.23137587321537, Y: 341.5804631559928, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.23137587321537, Y: 324.0804614933435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 270.9269188260254, Y: 308.3633155420524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.75, Y: 297.63147110363275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.75, Y: 277.63147110363275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 270.9269181079641, Y: 266.89962578262885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 263.2313753596257, Y: 251.18247849705634, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 263.2313766436001, Y: 233.68247572597423, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 270.9269216982711, Y: 217.96532956964512, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 284.7500051650968, Y: 207.233486277039, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 301.8841054340322, Y: 203.67361198684955, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.679013993194, Y: 185.71116272635106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.4739225523558, Y: 167.74871346585257, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 320.58902253763114, Y: 150.28435111327678, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 333.7000829730827, Y: 138.6935144473082, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 342.494928579124, Y: 120.73103436336942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 351.2897741851653, Y: 102.76855427943065, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 360.0846197912066, Y: 84.80607419549187, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 368.8794653972479, Y: 66.8435941115531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 377.6743110032892, Y: 48.88111402761433, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 376.3683912536064, Y: 31.429932823281433, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 386.61571895015356, Y: 17.243974029507626, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 403.59328757042243, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 419.3104358789494, Y: 20.695479248678225, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 426.3697319742645, Y: 36.70845806143325, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 421.44864805982843, Y: 53.50226897278253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 406.8633411396896, Y: 63.17273813743145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 398.06849553364833, Y: 81.13521822137022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 389.27364992760704, Y: 99.097698305309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 380.47880432156575, Y: 117.06017838924777, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 371.68395871552445, Y: 135.02265847318654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 362.88911310948316, Y: 152.9851385571253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 361.77403899518737, Y: 170.4495769883955, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 348.6629026006658, Y: 182.04043987449052, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 339.86799404150406, Y: 200.002889134989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 331.07308548234226, Y: 217.96533839548744, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 338.7686252823612, Y: 233.68248403922078, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 338.7686233563999, Y: 251.18248403922067, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 331.0730800968825, Y: 266.89962798908937, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 277.63147110363275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 297.63147110363275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 331.0730811739746, Y: 308.3633155420524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 338.76862412678463, Y: 324.0804614933435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 338.7686241267847, Y: 341.5804631559928, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 331.0730811739746, Y: 357.29760910728373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.25, Y: 368.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.25, Y: 388.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.25, Y: 408.0294535457034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.25, Y: 428.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 387.25, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 422.25, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 457.25, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 492.25, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 509.75, Y: 448.02945354570346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 468.0294535457034, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 468.0294535457034, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 261.0, Y: 388.0294535457034, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 239.99742189603955, Y: 229.1685520009856, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 338.3721397072679, Y: 76.01122858945058, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 412.28097561758705, Y: 89.93006382741152, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 354.50257810396045, Y: 255.69640776420928, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 333.5, Y: 408.0294535457034, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 453.5, Y: 468.02945354570346, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '83', X: 506.0, Y: 468.02945354570346, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'BRCA1, -8.9 ± 0.7
 kcal/mol, AUC: 0.678', X: 191.25, Y: 480.8294535457035, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 524.0, 480.8294535457035)
Updated viewBox: -0.25 0.0 529.25 485.8294535457035
Updated SVG: /disk1/www/rails/humanrnamap/public/result/01b7cd35-4705-4399-b9d2-511da5fdd673/final_image/BRCA1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/01b7cd35-4705-4399-b9d2-511da5fdd673/final_image/BRCA1_fold_final_1.svg
