Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 46% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 63% [================================                  ] |                     
 69% [===================================               ] /                     
 75% [======================================            ] -                     
 81% [=========================================         ] \                     
 87% [============================================      ] |                     
 93% [===============================================   ] /                     
 98% [==================================================] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/02426b92-8960-4b6b-a6f1-527b4c4ab4ce/final_image/ATP13A3_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.48 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.48 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.48 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.10 MB
Based on canonical annotations, the following gene is in your area of interest: ATP13A3(-)
write fasta - Elapsed time since the previous call: 0.59 seconds
write fasta - Current memory usage: 172.10 MB
Length of region: 86 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.55 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/02426b92-8960-4b6b-a6f1-527b4c4ab4ce/fasta/ATP13A3.fasta" "/disk1/www/rails/humanrnamap/public/result/02426b92-8960-4b6b-a6f1-527b4c4ab4ce/ct/ATP13A3.ct" --SHAPE "ATP13A3.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 175.55 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/02426b92-8960-4b6b-a6f1-527b4c4ab4ce/ct/ATP13A3.ct" "/disk1/www/rails/humanrnamap/public/result/02426b92-8960-4b6b-a6f1-527b4c4ab4ce/fold_FE/ATP13A3.txt" -sh "ATP13A3.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 175.55 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/02426b92-8960-4b6b-a6f1-527b4c4ab4ce/ct/ATP13A3.ct" 1 "/disk1/www/rails/humanrnamap/public/result/02426b92-8960-4b6b-a6f1-527b4c4ab4ce/fold_dbn/ATP13A3_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.55 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGAAACAGCUAUAGAUAACAUUAUCCAGUGAAGAGCAAAAUUCAAGCUUUAGAAAAUAUUCAUGCAUGCAAUUUUGACAUAUCUAA', '-structureDBN', '...........((((((.((((....)))).....(((((((((.((................)).)).)))))))...)))))).', '-o', '/disk1/www/rails/humanrnamap/public/result/02426b92-8960-4b6b-a6f1-527b4c4ab4ce/final_image/ATP13A3_fold_1.svg', '-title', 'ATP13A3, -3.8 ± 0.6\n kcal/mol, AUC: 0.607', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,8,10,12,14,16,21,22,24,28,29,30,33,35,41,42,46,48,49,50,52,57,59,60,63,64,67,68,72,73,74,75,76,80,82,84', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '65,5,6,7,38,11,13,18,85', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '66,4,36,37,9,45,17,19,20,54,23,27,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,3,69,70,71,77,78,15,79,81,83,86,25,26,32,34,39,40,43,44,47,51,53,55,56,58,61,62']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 392.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 372.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 352.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 332.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 312.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 182.0035872394474, Y: 304.2281334090967, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 170.70801570663556, Y: 290.86144230997854, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 151.0622285824202, Y: 294.6088478484829, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 131.41644145820484, Y: 298.3562533869874, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.77065433398948, Y: 302.1036589254918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 95.60263447859094, Y: 308.8004033249763, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 80.20160091822208, Y: 300.4902037564352, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 76.92261437169472, Y: 283.3001048962111, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 88.18324578877915, Y: 269.9042312149181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 105.68112033391978, Y: 270.1792548486419, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 125.32690745813514, Y: 266.4318493101374, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.9726945823505, Y: 262.684443771633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 164.61848170656583, Y: 258.93703823312853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 170.20048705627852, Y: 242.35116423518141, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 181.21374035291177, Y: 228.75122850650254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 196.27680089910723, Y: 219.84313067466152, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 213.5002428998865, Y: 216.7442525476948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 230.72365443266696, Y: 219.84330000981694, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 245.7866273966007, Y: 228.75154593636174, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.1071682444505, Y: 218.7516026996246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 280.42770909230035, Y: 208.75165946288743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 297.7482499401502, Y: 198.75171622615025, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 315.068790788, Y: 188.75177298941315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.3893316358498, Y: 178.75182975267603, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.70987248369966, Y: 168.75188651593885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 362.5930455407671, Y: 156.90796859817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 374.0110855944269, Y: 140.48760437160604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 377.7626395353352, Y: 123.39452848141934, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 392.4802988216683, Y: 113.92679879101115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 403.898281326743, Y: 97.50639454769816, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 395.753528534347, Y: 82.01727680454337, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 393.1160339536676, Y: 64.71717886125305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 396.2752508198021, Y: 47.504709099383035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.8844692100173, Y: 32.26885909946077, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 417.9988659072486, Y: 20.681695262774838, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 434.17919452283206, Y: 14.014857001478504, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 451.64973635121004, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 468.49317755667965, Y: 17.74850027571256, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 482.8610257924473, Y: 27.73923115911157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 493.1764739690517, Y: 41.87575461526376, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 498.3074477807977, Y: 58.606650414763976, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 497.69084579805974, Y: 76.0957775658095, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 491.3943373309395, Y: 92.42378257665018, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 480.1089360251053, Y: 105.79873991777208, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 465.0731642044606, Y: 114.75280783509663, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 447.9371305848878, Y: 118.30331741815985, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 430.5814382221265, Y: 116.0606161184445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 419.1634557170519, Y: 132.4810203617575, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 415.4119158064967, Y: 149.57417537478864, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 400.69417746259325, Y: 159.04191945880325, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 389.27613740893344, Y: 175.4622836853672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 382.6584293653376, Y: 191.66277566091304, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 365.9597802433975, Y: 196.8977653936948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 348.6392393955477, Y: 206.897708630432, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 331.31869854769786, Y: 216.89765186716912, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 313.99815769984804, Y: 226.89759510390624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 296.6776168519982, Y: 236.89753834064342, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.3570760041484, Y: 246.8974815773806, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.03653515629856, Y: 256.8974248141177, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.21970125327636, Y: 274.396466221604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 256.29174139485673, Y: 290.8618630257191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.99622560346268, Y: 304.2282882399029, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 312.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 332.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 352.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 372.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 392.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 412.8191324852794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 412.81913248527945, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 432.8191324852794, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 432.8191324852794, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 151.05963412092464, Y: 314.25463497269834, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 149.11296415819072, Y: 242.7565621224004, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 301.3188475512629, Y: 171.43123214156327, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 373.72362868080904, Y: 40.68569121243439, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 504.85520922353976, Y: 102.61131852488137, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 374.0490793955819, Y: 213.0170394339575, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 244.09654404042942, Y: 321.3347119601478, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '86', X: 243.5, Y: 432.81913248527945, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ATP13A3, -3.8 ± 0.6
 kcal/mol, AUC: 0.607', X: 185.52872389039885, Y: 445.61913248527947, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 522.8552092235398, 445.61913248527947)
Updated viewBox: -0.25 0.0 528.1052092235398 450.61913248527947
Updated SVG: /disk1/www/rails/humanrnamap/public/result/02426b92-8960-4b6b-a6f1-527b4c4ab4ce/final_image/ATP13A3_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/02426b92-8960-4b6b-a6f1-527b4c4ab4ce/final_image/ATP13A3_fold_final_1.svg
