Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 13% [=======                                           ] \                     
 19% [==========                                        ] |                     
 26% [==============                                    ] /                     
 32% [=================                                 ] -                     
 39% [====================                              ] \                     
 46% [========================                          ] |                     
 52% [===========================                       ] /                     
 59% [==============================                    ] -                     
 65% [=================================                 ] \                     
 72% [=====================================             ] |                     
 78% [========================================          ] /                     
 85% [===========================================       ] -                     
 92% [===============================================   ] \                     
 98% [==================================================] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/02e4d859-91aa-4b2e-ad4d-4f1745f78180/final_image/MLLT6_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.96 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.96 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.96 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.57 MB
Based on canonical annotations, the following gene is in your area of interest: MLLT6(+)
write fasta - Elapsed time since the previous call: 0.63 seconds
write fasta - Current memory usage: 172.57 MB
Length of region: 76 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.21 seconds
write dat - Current memory usage: 175.96 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/02e4d859-91aa-4b2e-ad4d-4f1745f78180/fasta/MLLT6.fasta" "/disk1/www/rails/humanrnamap/public/result/02e4d859-91aa-4b2e-ad4d-4f1745f78180/ct/MLLT6.ct" --SHAPE "MLLT6.dat"

fold - Elapsed time since the previous call: 0.07 seconds
fold - Current memory usage: 175.96 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/02e4d859-91aa-4b2e-ad4d-4f1745f78180/ct/MLLT6.ct" "/disk1/www/rails/humanrnamap/public/result/02e4d859-91aa-4b2e-ad4d-4f1745f78180/fold_FE/MLLT6.txt" -sh "MLLT6.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 175.96 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/02e4d859-91aa-4b2e-ad4d-4f1745f78180/ct/MLLT6.ct" 1 "/disk1/www/rails/humanrnamap/public/result/02e4d859-91aa-4b2e-ad4d-4f1745f78180/fold_dbn/MLLT6_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.96 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACCUCGGCCCUGCCCCGCCUCAGCCGCUCCCCGUUCACCAGCACCCUCCCCUCCUCUUCUGCUUCUAUCUCCACCA', '-structureDBN', '.....(((........)))....................((((................)))).............', '-o', '/disk1/www/rails/humanrnamap/public/result/02e4d859-91aa-4b2e-ad4d-4f1745f78180/final_image/MLLT6_fold_1.svg', '-title', 'MLLT6, -4.6 ± 0.5\n kcal/mol, AUC: 0.608', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '64,66,4,68,6,7,70,11,12,17,20,23,26,28,33,34,35,41,47,52,55,57,58,60,61,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '8,9,10,43,72,73,14,74,48,49,54,29,30', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '69,39,42,75,44,45,15,50,19,21,53,24,59,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,3,65,5,67,71,76,13,16,18,22,25,27,31,32,36,37,38,40,46,51,56']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25, Y: 162.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 142.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 80.59493192571631, Y: 129.147744776597, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 77.9117893094517, Y: 111.85464630480725, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 85.06324539329535, Y: 95.88257114423122, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 99.74999272779968, Y: 86.36679677812398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 117.25000727220032, Y: 86.36679677812398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 131.93675460670465, Y: 95.88257114423125, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 139.0882106905483, Y: 111.85464630480725, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 136.4050680742837, Y: 129.147744776597, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 142.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 162.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 142.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 334.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 369.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 404.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 422.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 457.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 474.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 492.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 492.25, Y: 162.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 492.25, Y: 142.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 492.25, Y: 122.20185896477717, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 476.72026956383115, Y: 114.13481247362027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 464.6782224209876, Y: 101.43682573870488, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 457.4454193921908, Y: 85.50144601755662, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 455.81562826405286, Y: 68.0775099700042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 459.96771132430246, Y: 51.07721665573047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 469.44599602559646, Y: 36.36627223901229, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 483.2102830097785, Y: 25.5591370808109, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 499.7500033355641, Y: 19.841845934179787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 517.2499966644359, Y: 19.841845934179787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 533.7897169902216, Y: 25.5591370808109, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 547.5540039744035, Y: 36.36627223901229, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 557.0322886756975, Y: 51.07721665573041, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 561.1843717359471, Y: 68.0775099700042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 559.5545806078092, Y: 85.50144601755667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 552.3217775790124, Y: 101.43682573870488, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 540.2797304361688, Y: 114.1348124736203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 524.75, Y: 122.20185896477717, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 524.75, Y: 142.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 524.75, Y: 162.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 524.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 542.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 559.75, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 577.25, Y: 182.20185896477716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 594.75, Y: 182.2018589647772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 612.25, Y: 182.2018589647772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 629.75, Y: 182.2018589647772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 647.25, Y: 182.2018589647772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 664.75, Y: 182.2018589647772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 682.25, Y: 182.2018589647772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 699.75, Y: 182.2018589647772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 717.25, Y: 182.2018589647772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 734.75, Y: 182.2018589647772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 752.25, Y: 182.2018589647772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 202.20185896477716, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 54.339813393158835, Y: 109.19207785049372, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 138.5, Y: 202.20185896477716, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 313.5, Y: 202.20185896477716, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 474.35786437626905, Y: 196.3439945885081, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 469.8854877128914, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 538.897469714246, Y: 131.12825677283206, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 643.5, Y: 202.2018589647772, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '76', X: 748.5, Y: 202.2018589647772, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'MLLT6, -4.6 ± 0.5
 kcal/mol, AUC: 0.608', X: 312.5, Y: 215.0018589647772, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 766.5, 215.0018589647772)
Updated viewBox: -0.25 -5.0 771.75 225.0018589647772
Updated SVG: /disk1/www/rails/humanrnamap/public/result/02e4d859-91aa-4b2e-ad4d-4f1745f78180/final_image/MLLT6_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/02e4d859-91aa-4b2e-ad4d-4f1745f78180/final_image/MLLT6_fold_final_1.svg
