Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 16% [=========                                         ] |                     
 21% [===========                                       ] /                     
 27% [==============                                    ] -                     
 32% [=================                                 ] \                     
 38% [====================                              ] |                     
 43% [======================                            ] /                     
 48% [=========================                         ] -                     
 54% [============================                      ] \                     
 59% [==============================                    ] |                     
 65% [=================================                 ] /                     
 70% [====================================              ] -                     
 76% [=======================================           ] \                     
 81% [=========================================         ] |                     
 86% [============================================      ] /                     
 92% [===============================================   ] -                     
 97% [================================================= ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/0367a3c4-244a-47aa-a3be-5c117bc09e1b/final_image/CLASP1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.63 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.63 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.63 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.10 MB
Based on canonical annotations, the following gene is in your area of interest: CLASP1(-)
write fasta - Elapsed time since the previous call: 1.60 seconds
write fasta - Current memory usage: 170.10 MB
Length of region: 92 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.28 seconds
write dat - Current memory usage: 173.31 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/0367a3c4-244a-47aa-a3be-5c117bc09e1b/fasta/CLASP1.fasta" "/disk1/www/rails/humanrnamap/public/result/0367a3c4-244a-47aa-a3be-5c117bc09e1b/ct/CLASP1.ct" --SHAPE "CLASP1.dat"

fold - Elapsed time since the previous call: 0.12 seconds
fold - Current memory usage: 173.31 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/0367a3c4-244a-47aa-a3be-5c117bc09e1b/ct/CLASP1.ct" "/disk1/www/rails/humanrnamap/public/result/0367a3c4-244a-47aa-a3be-5c117bc09e1b/fold_FE/CLASP1.txt" -sh "CLASP1.dat"

efn2 - Elapsed time since the previous call: 0.55 seconds
efn2 - Current memory usage: 173.31 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/0367a3c4-244a-47aa-a3be-5c117bc09e1b/ct/CLASP1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/0367a3c4-244a-47aa-a3be-5c117bc09e1b/fold_dbn/CLASP1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.31 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACAGAUUUAUUCCAGCCGAGACCUUGAGGAAUCCAUAAACAAAAUUAGGGAAAUAUUAUCUGAUGACAAGCAUGAUUGGGAGCAGAGAGUAA', '-structureDBN', '.........((((...(((....))).)))).((.(((......))).))...((((.((((....(((......)))....)))).)))).', '-o', '/disk1/www/rails/humanrnamap/public/result/0367a3c4-244a-47aa-a3be-5c117bc09e1b/final_image/CLASP1_fold_1.svg', '-title', 'CLASP1, -7.3 ± 1.1\n kcal/mol, AUC: 0.529', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,6,7,8,10,11,15,18,20,24,25,26,28,29,32,36,45,46,48,49,50,54,56,57,59,61,62,64,65,70,73,74,76,77,78,79,80,82,85,87,89,90', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,81,30,42,14', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,35,41,12,13,47,16,17,19,83,84,58,91,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '66,3,67,5,68,69,71,9,72,75,21,22,23,86,88,27,92,33,34,37,38,39,40,43,44,51,52,53,55,60,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 299.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 279.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 259.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 151.87031610366017, Y: 245.28297398342445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 151.87031784047466, Y: 227.78296869761814, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25000453347002, Y: 213.69352977484672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 178.96359459307448, Y: 208.5064214934686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 190.8260916858514, Y: 192.40421162265088, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 202.68858877862831, Y: 176.30200175183322, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.99551673716437, Y: 160.40042776038976, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 226.94036262229437, Y: 156.02739111227206, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 241.0298250499032, Y: 166.40709727851717, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 241.87585436515428, Y: 183.88667067131834, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 228.85467981870707, Y: 195.57855952759573, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 216.99218272593015, Y: 211.6807693984134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 205.12968563315323, Y: 227.7829792692311, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 205.12968215952534, Y: 245.28297926923076, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 259.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 279.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 299.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 319.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 299.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 223.07162284851074, Y: 283.19687853640824, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 267.0213421063255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 247.02134210632548, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 227.02134210632548, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 220.90309990849715, Y: 211.92228549374076, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 223.8683050233931, Y: 194.67535213022163, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 237.2500121168788, Y: 183.39798244207063, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 254.7499878831212, Y: 183.39798244207063, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 268.13169497660687, Y: 194.67535213022163, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 271.09690009150285, Y: 211.9222854937407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 262.25, Y: 227.02134210632548, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 262.25, Y: 247.02134210632548, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.25, Y: 267.0213421063255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 268.92837715148926, Y: 283.19687853640824, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.25, Y: 299.37241496649096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.25, Y: 319.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.75, Y: 319.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 297.25, Y: 319.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 314.75, Y: 319.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 319.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.25, Y: 299.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 279.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 259.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 325.57162284851074, Y: 243.19687853640826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 227.0213421063255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 207.02134210632548, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 187.02134210632548, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 167.02134210632548, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 318.4269188260255, Y: 156.28949766790586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 310.73137587321537, Y: 140.57235171661486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 310.73137587321537, Y: 123.07235005396555, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 318.4269188260254, Y: 107.35520410267449, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 96.62335966425479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.25, Y: 76.62335966425485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.25, Y: 56.62335966425485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 323.40309990849715, Y: 41.52430305167013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 326.3683050233931, Y: 24.27736968815111, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 339.7500121168788, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 357.2499878831212, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 370.63169497660687, Y: 24.277369688150998, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 373.59690009150285, Y: 41.52430305167013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 364.75, Y: 56.62335966425485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 364.75, Y: 76.62335966425485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 364.75, Y: 96.62335966425479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 378.5730811739746, Y: 107.35520410267449, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 386.26862412678463, Y: 123.07235005396555, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 386.2686241267847, Y: 140.5723517166148, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 378.5730811739746, Y: 156.2894976679058, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 364.75, Y: 167.02134210632548, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 364.75, Y: 187.02134210632548, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 364.75, Y: 207.02134210632548, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 364.75, Y: 227.02134210632548, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 371.42837715148926, Y: 243.19687853640826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 364.75, Y: 259.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 364.75, Y: 279.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 364.75, Y: 299.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 364.75, Y: 319.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 382.25, Y: 319.372414966491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 339.37241496649096, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 144.35786437626905, Y: 333.5145505902219, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 193.41764861783938, Y: 145.0561845560735, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 211.0, Y: 299.37241496649096, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 202.76585362223548, Y: 184.7308848056002, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 272.64213562373095, Y: 333.514550590222, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 308.5, Y: 207.02134210632548, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 299.9757665809854, Y: 45.10236860696608, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 402.0025792717687, Y: 118.55842804442116, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 381.0, Y: 299.372414966491, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '92', X: 378.5, Y: 339.372414966491, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLASP1, -7.3 ± 1.1
 kcal/mol, AUC: 0.529', X: 129.50931206339234, Y: 352.17241496649103, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 420.0025792717687, 352.17241496649103)
Updated viewBox: -0.25 0.0 425.2525792717687 357.17241496649103
Updated SVG: /disk1/www/rails/humanrnamap/public/result/0367a3c4-244a-47aa-a3be-5c117bc09e1b/final_image/CLASP1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/0367a3c4-244a-47aa-a3be-5c117bc09e1b/final_image/CLASP1_fold_final_1.svg
