Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/0434e585-736a-44b2-b3b5-223b4dbbc072/final_image/MYH10_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.95 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.95 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.95 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.57 MB
Based on canonical annotations, the following gene is in your area of interest: MYH10(-)
write fasta - Elapsed time since the previous call: 0.57 seconds
write fasta - Current memory usage: 171.57 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 174.71 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/0434e585-736a-44b2-b3b5-223b4dbbc072/fasta/MYH10.fasta" "/disk1/www/rails/humanrnamap/public/result/0434e585-736a-44b2-b3b5-223b4dbbc072/ct/MYH10.ct" --SHAPE "MYH10.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 174.71 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/0434e585-736a-44b2-b3b5-223b4dbbc072/ct/MYH10.ct" "/disk1/www/rails/humanrnamap/public/result/0434e585-736a-44b2-b3b5-223b4dbbc072/fold_FE/MYH10.txt" -sh "MYH10.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 174.71 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/0434e585-736a-44b2-b3b5-223b4dbbc072/ct/MYH10.ct" 1 "/disk1/www/rails/humanrnamap/public/result/0434e585-736a-44b2-b3b5-223b4dbbc072/fold_dbn/MYH10_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 174.71 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AUGUUUCGUACCGUUGGGCAACUCUACAAAGAAUCUCUCACCAAGCUGAUGGCAACUCUCCGAAACACCAACCCUAACUUUGUUC', '-structureDBN', '.(((((((..(((((((............................)))))))........))))))).(((........)))...', '-o', '/disk1/www/rails/humanrnamap/public/result/0434e585-736a-44b2-b3b5-223b4dbbc072/final_image/MYH10_fold_1.svg', '-title', 'MYH10, -11.1 ± 0.8\n kcal/mol, AUC: 0.637', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,5,6,8,9,13,14,15,16,17,18,23,25,31,34,36,38,45,47,48,50,51,52,57,59,62,75,79,80,81,82,83,84', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '65,67,69,70,72,74,20,53,26,63', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,68,7,71,73,10,77,78,21,85,33,39,43,44,49,58,60,61', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,66,11,12,76,19,22,24,27,28,29,30,32,35,37,40,41,42,46,54,55,56']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 300.382518223594, Y: 350.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.882518223594, Y: 350.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.882518223594, Y: 330.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.882518223594, Y: 310.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.882518223594, Y: 290.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.882518223594, Y: 270.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.882518223594, Y: 250.65470081171748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.882518223594, Y: 230.65470081171748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 303.1989544537252, Y: 221.13382691975448, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 293.35632942228466, Y: 206.66396800057618, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 289.8949617668855, Y: 189.50958026435484, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 271.2932316692292, Y: 182.16276888975506, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 252.69150157157304, Y: 174.81595751515528, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 234.08977147391673, Y: 167.46914614055544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 215.48804137626044, Y: 160.1223347659556, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 196.8863112786042, Y: 152.77552339135582, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 178.28458118094798, Y: 145.42871201675604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 167.44789056687173, Y: 159.16977391438144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 154.05698786092572, Y: 170.4362893588065, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 138.66488358449308, Y: 178.76297966666607, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 121.9072328385038, Y: 183.8059735210175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 104.47608435034371, Y: 185.35700798978166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 87.09130060616647, Y: 183.35202925977734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 70.47082934509123, Y: 177.87383789771678, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 55.301054127626024, Y: 169.14866939555264, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 42.20844842508864, Y: 157.53685121503224, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 31.73370384467062, Y: 143.5179221719639, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 24.309400929220764, Y: 127.67082869211015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 20.242144671422288, Y: 110.6500157834098, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 19.699902500590206, Y: 93.15840010709928, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.705067651309996, Y: 75.91834129175652, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.133534379306234, Y: 59.64181030181197, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 38.71982321579281, Y: 45.000986831698185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 51.06804460022183, Y: 32.600499979130234, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 65.66824812104065, Y: 22.952458587726028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 81.91748218203159, Y: 16.455302442864536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 99.14469438310849, Y: 13.377347713072709, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 116.63844429262176, Y: 13.845706168728782, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 133.67628414354297, Y: 17.84103578641259, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 149.55459410484937, Y: 25.198339525708604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 163.61764000661927, Y: 35.61377929099416, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 175.28465350805075, Y: 48.65722367876981, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 184.07381636573703, Y: 63.79001132020096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 189.62215831238657, Y: 80.38719623760875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 191.70054681376294, Y: 97.76335653777079, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 190.22314966467266, Y: 115.20090060806461, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 208.82487976232895, Y: 122.5477119826644, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.42660985998518, Y: 129.89452335726418, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 246.0283399576414, Y: 137.24133473186401, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.6300700552977, Y: 144.58814610646385, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 283.23180015295395, Y: 151.93495748106363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 301.8335302506102, Y: 159.28176885566342, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 316.0825265435879, Y: 149.12223615761536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 333.1562131693635, Y: 145.28306632485067, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 350.38268432254705, Y: 148.3650610699038, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 365.06612454808095, Y: 157.88591098696332, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 374.90868394151215, Y: 172.3556734102645, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 378.37007468102337, Y: 189.50993743261262, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 374.90861469089583, Y: 206.66418748141234, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 365.06599688405817, Y: 221.13391017082563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 350.382518223594, Y: 230.65470081171748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 350.382518223594, Y: 250.65470081171748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 350.382518223594, Y: 270.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 350.382518223594, Y: 290.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 350.382518223594, Y: 310.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 350.382518223594, Y: 330.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 350.382518223594, Y: 350.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 367.882518223594, Y: 350.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 385.382518223594, Y: 350.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 385.382518223594, Y: 330.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 385.382518223594, Y: 310.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 373.7274501493103, Y: 297.6005866235373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 371.0443075330457, Y: 280.3074881517476, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 378.19576361688934, Y: 264.33541299117155, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 392.8825109513937, Y: 254.81963862506433, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 410.3825254957943, Y: 254.81963862506433, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 425.06927283029864, Y: 264.33541299117155, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 432.2207289141423, Y: 280.3074881517476, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 429.5375862978777, Y: 297.6005866235373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 417.882518223594, Y: 310.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 417.882518223594, Y: 330.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 417.882518223594, Y: 350.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 435.382518223594, Y: 350.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 452.882518223594, Y: 350.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 470.382518223594, Y: 350.6547008117175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 301.132518223594, Y: 370.6547008117175, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 271.17122944542865, Y: 214.4194234251997, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 142.5944412045524, Y: 197.22982549263725, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: -4.0, Y: 91.74369511419627, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 156.01327264609304, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 268.22688142989756, Y: 125.98641600880762, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 375.3011629454653, Y: 235.43129210721057, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 361.632518223594, Y: 330.6547008117175, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 433.64744276265344, Y: 315.0327963148804, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 466.632518223594, Y: 370.6547008117175, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'MYH10, -11.1 ± 0.8
 kcal/mol, AUC: 0.637', X: 179.0412103620921, Y: 383.4547008117175, Width: 142.5, Height: 23
Calculated bounding box: (-4.0, 0.0, 484.632518223594, 383.4547008117175)
Updated viewBox: -9.0 -5.0 498.632518223594 393.4547008117175
Updated SVG: /disk1/www/rails/humanrnamap/public/result/0434e585-736a-44b2-b3b5-223b4dbbc072/final_image/MYH10_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/0434e585-736a-44b2-b3b5-223b4dbbc072/final_image/MYH10_fold_final_1.svg
