Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 13% [=======                                           ] \                     
 20% [===========                                       ] |                     
 26% [==============                                    ] /                     
 33% [=================                                 ] -                     
 40% [=====================                             ] \                     
 46% [========================                          ] |                     
 53% [===========================                       ] /                     
 60% [===============================                   ] -                     
 66% [==================================                ] \                     
 73% [=====================================             ] |                     
 80% [=========================================         ] /                     
 86% [============================================      ] -                     
 93% [===============================================   ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/05452be2-9b06-4bb6-8ef4-a0b4d35a7c88/final_image/TEX2_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.18 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.18 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.18 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.75 MB
Based on canonical annotations, the following gene is in your area of interest: TEX2(-)
write fasta - Elapsed time since the previous call: 0.58 seconds
write fasta - Current memory usage: 171.75 MB
Length of region: 75 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 175.12 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/05452be2-9b06-4bb6-8ef4-a0b4d35a7c88/fasta/TEX2.fasta" "/disk1/www/rails/humanrnamap/public/result/05452be2-9b06-4bb6-8ef4-a0b4d35a7c88/ct/TEX2.ct" --SHAPE "TEX2.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 175.12 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/05452be2-9b06-4bb6-8ef4-a0b4d35a7c88/ct/TEX2.ct" "/disk1/www/rails/humanrnamap/public/result/05452be2-9b06-4bb6-8ef4-a0b4d35a7c88/fold_FE/TEX2.txt" -sh "TEX2.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 175.12 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/05452be2-9b06-4bb6-8ef4-a0b4d35a7c88/ct/TEX2.ct" 1 "/disk1/www/rails/humanrnamap/public/result/05452be2-9b06-4bb6-8ef4-a0b4d35a7c88/fold_dbn/TEX2_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 175.12 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGACUUUCAAAGCCCAAUAAAAAUAUAUCCAGGAGGGCCAGCUACAAUGAACCCAAGCCAGAGGUCACCUACAUC', '-structureDBN', '.((((((....((((...................))))((.......))...........)))))).........', '-o', '/disk1/www/rails/humanrnamap/public/result/05452be2-9b06-4bb6-8ef4-a0b4d35a7c88/final_image/TEX2_fold_1.svg', '-title', 'TEX2, -7.5 ± 0.5\n kcal/mol, AUC: 0.778', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '64,65,2,5,6,7,70,74,12,18,24,26,28,32,33,35,36,37,41,43,48,49,57,61,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '66,3,19,53,62', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,67,4,8,9,10,11,72,13,14,15,16,20,21,23,25,29,30,31,38,39,40,54,55,56,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '68,69,71,73,75,17,22,27,34,42,44,45,46,47,50,51,52,58,59']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 208.9353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 226.4353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 226.4353736454504, Y: 279.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 226.4353736454504, Y: 259.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 226.4353736454504, Y: 239.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 226.4353736454504, Y: 219.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 226.4353736454504, Y: 199.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 210.19642634838323, Y: 192.49404798559272, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 196.24434948838052, Y: 181.93024882612295, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 185.5612183483085, Y: 168.06933217414573, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.89900979451883, Y: 151.88695662001751, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 176.7266712400474, Y: 134.52218634817703, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 157.38614414957868, Y: 129.42865988188234, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 138.04561705910993, Y: 124.33513341558765, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 118.70508996864123, Y: 119.2416069492929, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.83518828799697, Y: 132.95635061965785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 93.52501873998654, Y: 143.02948339937845, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 76.94728434083817, Y: 148.6355228821133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 59.46051260952299, Y: 149.315060156707, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 42.4977256974982, Y: 145.01240787376233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 27.449005763373634, Y: 136.08016376407912, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 15.547579233846363, Y: 123.25031563353005, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 7.768755223303401, Y: 107.57425574899, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 4.75, Y: 90.3366203719302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 6.738697310421344, Y: 72.95001519730766, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 13.57187554710515, Y: 56.83925383490151, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 24.689563096738254, Y: 43.32459586514807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.180677412101545, Y: 33.5135529853232, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 55.85768724773192, Y: 28.210129616123425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 73.35392956932378, Y: 27.84893560340214, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 90.23560612072401, Y: 32.45957040834941, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 105.11928165021186, Y: 41.66419746345656, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 116.78525494268752, Y: 54.708507473186216, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.27751202351374, Y: 70.5235332501332, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 126.98207047637015, Y: 87.81325042728119, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 146.32259756683885, Y: 92.90677689357588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 165.6631246573076, Y: 98.00030335987063, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 185.00365174777636, Y: 103.09382982616538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 195.44725454659198, Y: 89.05170888306807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 185.00456574590837, Y: 71.99444501654847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 168.76178845729729, Y: 65.48119863850724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.49934735715462, Y: 50.6333914840863, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 160.79186185654365, Y: 33.181182492174855, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 172.14051664655776, Y: 19.859837706997325, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 189.16556763347035, Y: 15.810414128077298, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 205.29660027167924, Y: 22.595690721814947, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.30822518859796, Y: 37.597050952982556, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.7226195290028, Y: 55.025075715437595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 223.1653083296864, Y: 72.08233958195723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 240.42072236416965, Y: 69.16674590338022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 257.8355411118532, Y: 70.89130033433577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 274.1839669363168, Y: 77.13461460337697, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 288.31526367285085, Y: 87.45723309598938, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.2347548685922, Y: 101.1325653415374, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 306.1738372614236, Y: 117.19802940410014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 308.6440813753168, Y: 134.52280628629333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 306.47161118893246, Y: 151.88743623597193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.8093429547017, Y: 168.06965431555417, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 289.12622170002, Y: 181.93042342328297, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 275.1742130337928, Y: 192.4941090574507, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 258.9353736454504, Y: 199.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 258.9353736454504, Y: 219.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 258.9353736454504, Y: 239.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 258.9353736454504, Y: 259.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 258.9353736454504, Y: 279.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 258.9353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 276.4353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 293.9353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 311.4353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 328.9353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 346.4353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 363.9353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 381.4353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 398.9353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 416.4353736454504, Y: 299.01715246675127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 209.6853736454504, Y: 319.01715246675127, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 164.4906695442727, Y: 178.0692616302476, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 31.106233285304796, Y: 163.49503738675074, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 72.05744855478011, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 161.28009779990455, Y: 73.0047074943563, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 235.98406007853043, Y: 49.178537006496015, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 281.2751163037869, Y: 209.89984675411898, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 325.1853736454504, Y: 319.01715246675127, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '75', X: 412.6853736454504, Y: 319.01715246675127, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TEX2, -7.5 ± 0.5
 kcal/mol, AUC: 0.778', X: 144.5926868227252, Y: 331.8171524667513, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 430.6853736454504, 331.8171524667513)
Updated viewBox: -0.25 -5.0 435.9353736454504 341.8171524667513
Updated SVG: /disk1/www/rails/humanrnamap/public/result/05452be2-9b06-4bb6-8ef4-a0b4d35a7c88/final_image/TEX2_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/05452be2-9b06-4bb6-8ef4-a0b4d35a7c88/final_image/TEX2_fold_final_1.svg
