Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  7% [====                                              ] -                     
 14% [========                                          ] \                     
 21% [===========                                       ] |                     
 28% [===============                                   ] /                     
 35% [==================                                ] -                     
 42% [======================                            ] \                     
 49% [=========================                         ] |                     
 56% [=============================                     ] /                     
 63% [================================                  ] -                     
 70% [====================================              ] \                     
 77% [=======================================           ] |                     
 84% [===========================================       ] /                     
 91% [==============================================    ] -                     
 98% [==================================================] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/0a7cb7b3-f3a7-45e4-b0e6-b25d1b8cd515/final_image/TNRC18_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.77 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.77 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.77 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.41 MB
Based on canonical annotations, the following gene is in your area of interest: TNRC18(-)
write fasta - Elapsed time since the previous call: 0.43 seconds
write fasta - Current memory usage: 172.41 MB
Length of region: 71 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.21 seconds
write dat - Current memory usage: 176.01 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/0a7cb7b3-f3a7-45e4-b0e6-b25d1b8cd515/fasta/TNRC18.fasta" "/disk1/www/rails/humanrnamap/public/result/0a7cb7b3-f3a7-45e4-b0e6-b25d1b8cd515/ct/TNRC18.ct" --SHAPE "TNRC18.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 176.01 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/0a7cb7b3-f3a7-45e4-b0e6-b25d1b8cd515/ct/TNRC18.ct" "/disk1/www/rails/humanrnamap/public/result/0a7cb7b3-f3a7-45e4-b0e6-b25d1b8cd515/fold_FE/TNRC18.txt" -sh "TNRC18.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 176.01 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/0a7cb7b3-f3a7-45e4-b0e6-b25d1b8cd515/ct/TNRC18.ct" 1 "/disk1/www/rails/humanrnamap/public/result/0a7cb7b3-f3a7-45e4-b0e6-b25d1b8cd515/fold_dbn/TNRC18_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.03 seconds
ct2dot - Current memory usage: 176.01 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CUAGCACCGGCUUCACCGGCCUCCCAGUCCCCAGCACACCCCCCGCCCACCCCACCAAGUGUACUGUACUC', '-structureDBN', '......((((.....))))............(((.((((...................)))).))).....', '-o', '/disk1/www/rails/humanrnamap/public/result/0a7cb7b3-f3a7-45e4-b0e6-b25d1b8cd515/final_image/TNRC18_fold_1.svg', '-title', 'TNRC18, -8.4 ± 0.6\n kcal/mol, AUC: 0.483', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '65,2,66,4,67,70,9,10,12,13,18,19,22,27,28,34,45,59,60,61,62', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '3,8,40,47,49,51,52,54,23,29,30', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,5,7,71,11,16,17,21,24,31,33,36,38,41,50,58', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,68,69,6,14,15,20,25,26,32,35,37,39,42,43,44,46,48,53,55,56,57,63']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 257.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 109.75, Y: 237.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 109.75, Y: 217.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 103.1018303951821, Y: 200.90253424562627, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.82804965122153, Y: 184.74676801937284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 126.0, Y: 178.0595541186284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.1719503487785, Y: 184.74676801937284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 148.89816960481792, Y: 200.90253424562627, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.25, Y: 217.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.25, Y: 237.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 257.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 282.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 299.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 334.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 257.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 369.75, Y: 237.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 363.07162284851074, Y: 220.91503811519812, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 204.73950168511539, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 184.73950168511539, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 164.73950168511539, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 144.73950168511536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 353.7191748304045, Y: 137.7208407820264, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 340.3337285933029, Y: 126.44791811200193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 330.6905842233361, Y: 111.84453757355587, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 325.5799870387475, Y: 95.10743050848751, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 325.42074498677965, Y: 77.60818485447223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 330.225907782464, Y: 60.78084498752773, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 339.6016974984977, Y: 46.00439332647585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.77977824321806, Y: 34.48974420562473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 368.68022046124247, Y: 27.180510746365428, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 386.0, Y: 24.67567677591495, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 403.3197795387576, Y: 27.180510746365428, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 419.22022175678194, Y: 34.48974420562473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 432.3983025015023, Y: 46.00439332647585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 441.774092217536, Y: 60.78084498752773, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 446.57925501322035, Y: 77.60818485447223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 446.4200129612525, Y: 95.10743050848745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 441.3094157766639, Y: 111.84453757355587, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 431.6662714066971, Y: 126.44791811200193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 418.2808251695955, Y: 137.7208407820264, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 402.25, Y: 144.73950168511536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 164.73950168511539, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 402.25, Y: 184.73950168511539, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 204.73950168511533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 408.92837715148926, Y: 220.91503811519812, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 237.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 257.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 402.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 419.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 454.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 472.25, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 489.75, Y: 277.0905745452809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 297.0905745452809, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 86.00001455787354, Y: 217.0664433470177, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 156.0, Y: 297.0905745452809, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 331.0, Y: 297.0905745452809, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 339.40807990873924, Y: 154.70504738862348, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 405.23617235152307, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 418.5, Y: 164.73950168511539, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 468.5, Y: 297.0905745452809, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '71', X: 486.0, Y: 297.0905745452809, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TNRC18, -8.4 ± 0.6
 kcal/mol, AUC: 0.483', X: 181.25, Y: 309.8905745452809, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 504.0, 309.8905745452809)
Updated viewBox: -0.25 -5.0 509.25 319.8905745452809
Updated SVG: /disk1/www/rails/humanrnamap/public/result/0a7cb7b3-f3a7-45e4-b0e6-b25d1b8cd515/final_image/TNRC18_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/0a7cb7b3-f3a7-45e4-b0e6-b25d1b8cd515/final_image/TNRC18_fold_final_1.svg
