Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 21% [===========                                       ] /                     
 26% [==============                                    ] -                     
 31% [================                                  ] \                     
 36% [===================                               ] |                     
 42% [======================                            ] /                     
 47% [========================                          ] -                     
 52% [===========================                       ] \                     
 57% [=============================                     ] |                     
 63% [================================                  ] /                     
 68% [===================================               ] -                     
 73% [=====================================             ] \                     
 78% [========================================          ] |                     
 84% [===========================================       ] /                     
 89% [=============================================     ] -                     
 94% [================================================  ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/0b295cbe-21cd-4e2c-aaa8-a6e5fef7c41f/final_image/KRAS_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.13 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.13 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.13 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 169.66 MB
Based on canonical annotations, the following gene is in your area of interest: KRAS(-)
write fasta - Elapsed time since the previous call: 0.55 seconds
write fasta - Current memory usage: 169.66 MB
Length of region: 95 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 173.20 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/0b295cbe-21cd-4e2c-aaa8-a6e5fef7c41f/fasta/KRAS.fasta" "/disk1/www/rails/humanrnamap/public/result/0b295cbe-21cd-4e2c-aaa8-a6e5fef7c41f/ct/KRAS.ct" --SHAPE "KRAS.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 173.20 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/0b295cbe-21cd-4e2c-aaa8-a6e5fef7c41f/ct/KRAS.ct" "/disk1/www/rails/humanrnamap/public/result/0b295cbe-21cd-4e2c-aaa8-a6e5fef7c41f/fold_FE/KRAS.txt" -sh "KRAS.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 173.20 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/0b295cbe-21cd-4e2c-aaa8-a6e5fef7c41f/ct/KRAS.ct" 1 "/disk1/www/rails/humanrnamap/public/result/0b295cbe-21cd-4e2c-aaa8-a6e5fef7c41f/fold_dbn/KRAS_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.20 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AUCUCUCCCCCCACACCCCCACAGAGCUAACUGGGUUACAGUGUUUUAUCCGAAAGUUUCCAAUUCCACUGUCUUGUGUUUUCAUGUUGAAAAUA', '-structureDBN', '..............((((..............)))).((((((.......................))))))....(((((((.....)))))))', '-o', '/disk1/www/rails/humanrnamap/public/result/0b295cbe-21cd-4e2c-aaa8-a6e5fef7c41f/final_image/KRAS_fold_1.svg', '-title', 'KRAS, -14.3 ± 0.7\n kcal/mol, AUC: 0.7', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,4,6,24,26,28,32,33,34,35,36,37,41,42,43,44,45,46,47,49,52,56,57,58,59,64,65,70,71,72,74,75,76,77,78,79,80,81,82,85,86,87,88,89,94', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '7,8,9,10,11,15,17,18,23,90,91,92,93', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,66,3,67,5,68,73,12,13,16,19,20,21,83,29,95,38,48,50,53,61,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '69,39,40,14,51,84,55,22,54,25,27,60,63,30,31']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 255.60184364669024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 255.60184364669024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 255.60184364669024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 255.60184364669024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 255.60184364669024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 255.60184364669024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 255.60184364669024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.25, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 249.75, Y: 235.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 249.75, Y: 215.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 249.75, Y: 195.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 234.71097477612403, Y: 186.65323608418987, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 223.95487307065656, Y: 172.8490290046921, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 218.9540181864529, Y: 156.07877833813524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 220.39294020530548, Y: 138.63803980974495, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 228.07467572194338, Y: 122.91414727499264, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 240.94772870953307, Y: 111.05942822430549, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 257.25000204297146, Y: 104.69658757300218, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 274.74999795702854, Y: 104.69658757300218, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 291.052271290467, Y: 111.05942822430549, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 303.9253242780566, Y: 122.91414727499264, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 311.6070597946946, Y: 138.638039809745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 313.0459818135471, Y: 156.0787783381353, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 308.04512692934344, Y: 172.84902900469217, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 297.28902522387597, Y: 186.65323608418993, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 282.25, Y: 195.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 282.25, Y: 215.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 282.25, Y: 235.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.25, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 299.75, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.25, Y: 235.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 215.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.25, Y: 195.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.25, Y: 175.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.25, Y: 155.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 300.8012532954664, Y: 149.62789695973834, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 286.27210124548367, Y: 139.87325458408282, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 274.515484265852, Y: 126.91056719439828, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 266.2215798521686, Y: 111.50081519298269, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 261.87728539905606, Y: 94.54863501245407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 261.73763466928665, Y: 77.04921202647748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 265.8108259218575, Y: 60.02985774411914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 273.85774062950367, Y: 44.48970102495056, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 285.4059810395527, Y: 31.341033769287094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.7776024967888, Y: 21.355754411233875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 316.12891248981924, Y: 15.120053273408644, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 333.5, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 350.87108751018087, Y: 15.120053273408644, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 367.22239750321114, Y: 21.355754411233875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 381.5940189604473, Y: 31.341033769287094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 393.1422593704964, Y: 44.489701024950676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 401.1891740781425, Y: 60.029857744119084, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 405.26236533071335, Y: 77.04921202647753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 405.12271460094394, Y: 94.54863501245407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 400.7784201478314, Y: 111.50081519298269, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 392.484515734148, Y: 126.91056719439834, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 380.72789875451633, Y: 139.87325458408282, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 366.1987467045336, Y: 149.62789695973834, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.75, Y: 155.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 175.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.75, Y: 195.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.75, Y: 215.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 349.75, Y: 235.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.75, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 367.25, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 384.75, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 419.75, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.25, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 437.25, Y: 235.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.25, Y: 215.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.25, Y: 195.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.25, Y: 175.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.25, Y: 155.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 437.25, Y: 135.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 430.6018303951821, Y: 119.41380334703567, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.32804965122153, Y: 103.25803712078223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 453.5, Y: 96.5708232200378, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.67195034877847, Y: 103.25803712078223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 476.3981696048179, Y: 119.41380334703567, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 469.75, Y: 135.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 469.75, Y: 155.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 469.75, Y: 175.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 469.75, Y: 195.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 469.75, Y: 215.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.75, Y: 235.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 469.75, Y: 255.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 275.6018436466902, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 275.60184364669027, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 202.42691575429123, Y: 182.01113758609915, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 329.18845253894824, Y: 158.14991532999716, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 293.5, Y: 215.60184364669027, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 243.31731836515183, Y: 53.052686077052414, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 416.18268163484817, Y: 53.05268607705236, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 366.0, Y: 215.60184364669027, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 413.5, Y: 195.60184364669027, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 486.0, Y: 155.60184364669027, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '95', X: 466.0, Y: 275.60184364669027, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'KRAS, -14.3 ± 0.7
 kcal/mol, AUC: 0.7', X: 183.57408480240895, Y: 288.4018436466903, Width: 124.5, Height: 23
Calculated bounding box: (4.75, 5.0, 504.0, 288.4018436466903)
Updated viewBox: -0.25 0.0 509.25 293.4018436466903
Updated SVG: /disk1/www/rails/humanrnamap/public/result/0b295cbe-21cd-4e2c-aaa8-a6e5fef7c41f/final_image/KRAS_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/0b295cbe-21cd-4e2c-aaa8-a6e5fef7c41f/final_image/KRAS_fold_final_1.svg
