Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 16% [=========                                         ] |                     
 21% [===========                                       ] /                     
 26% [==============                                    ] -                     
 32% [=================                                 ] \                     
 37% [===================                               ] |                     
 43% [======================                            ] /                     
 48% [=========================                         ] -                     
 53% [===========================                       ] \                     
 59% [==============================                    ] |                     
 64% [=================================                 ] /                     
 69% [===================================               ] -                     
 75% [======================================            ] \                     
 80% [=========================================         ] |                     
 86% [============================================      ] /                     
 91% [==============================================    ] -                     
 96% [================================================= ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/0bffa335-0463-42d6-94fc-b91dd17f557f/final_image/KRAS_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.99 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.99 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.99 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.62 MB
Based on canonical annotations, the following gene is in your area of interest: KRAS(-)
write fasta - Elapsed time since the previous call: 0.56 seconds
write fasta - Current memory usage: 170.62 MB
Length of region: 93 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.22 seconds
write dat - Current memory usage: 173.74 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/0bffa335-0463-42d6-94fc-b91dd17f557f/fasta/KRAS.fasta" "/disk1/www/rails/humanrnamap/public/result/0bffa335-0463-42d6-94fc-b91dd17f557f/ct/KRAS.ct" --SHAPE "KRAS.dat"

fold - Elapsed time since the previous call: 0.12 seconds
fold - Current memory usage: 173.74 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/0bffa335-0463-42d6-94fc-b91dd17f557f/ct/KRAS.ct" "/disk1/www/rails/humanrnamap/public/result/0bffa335-0463-42d6-94fc-b91dd17f557f/fold_FE/KRAS.txt" -sh "KRAS.dat"

efn2 - Elapsed time since the previous call: 0.40 seconds
efn2 - Current memory usage: 173.74 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/0bffa335-0463-42d6-94fc-b91dd17f557f/ct/KRAS.ct" 1 "/disk1/www/rails/humanrnamap/public/result/0bffa335-0463-42d6-94fc-b91dd17f557f/fold_dbn/KRAS_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.74 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGUCACACUGCAUAGGAAUUUAGAACCUAACUUUUAUAGGUUAUCAAAACUGUUGUCACCAUUGCACAAUUUUGUCCUAAUAUAUACAUAGAA', '-structureDBN', '.((......)).((((.......((((((.......))))))..(((((.((.((.((....)))))).))))).))))..............', '-o', '/disk1/www/rails/humanrnamap/public/result/0bffa335-0463-42d6-94fc-b91dd17f557f/final_image/KRAS_fold_1.svg', '-title', 'KRAS, -12.4 ± 0.8\n kcal/mol, AUC: 0.742', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,9,10,13,15,16,19,20,21,23,28,32,33,34,35,37,39,40,41,42,44,51,52,53,54,55,56,62,63,64,70,71,72,73,74,75,78,81,83,85,89,91', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,4,68,38,14,47,57,26,27,60', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '66,69,6,8,11,76,77,79,22,24,25,90,29,36,43,48,58', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '65,67,5,7,12,80,17,18,82,84,86,87,88,92,93,30,31,45,46,49,50,59,61']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 299.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 13.403099908497154, Y: 284.6411873485898, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 16.368305023393106, Y: 267.3942539850708, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 29.750012116878793, Y: 256.11688429691975, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 47.24998788312121, Y: 256.11688429691975, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 60.631694976606894, Y: 267.3942539850708, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 63.596900091502846, Y: 284.6411873485899, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.75, Y: 299.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.75, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 72.25, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 299.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 279.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 259.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.2711943042453, Y: 251.57596976685375, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 62.363910150026044, Y: 238.75156401229108, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 55.36847916739998, Y: 222.71059321079977, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 54.07233510620142, Y: 205.25869332970942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 58.62137713704189, Y: 188.36032016870283, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 68.50354685588664, Y: 173.9176223412563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 82.60646763039725, Y: 163.55632780269318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 99.34265817219132, Y: 158.44274539544253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 103.09690636970076, Y: 138.79826473365105, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 106.8511545672102, Y: 119.15378407185972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 110.60540276471966, Y: 99.50930341006824, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 114.35965096222907, Y: 79.86482274827688, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 118.11389915973854, Y: 60.2203420864854, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 110.48231615589074, Y: 44.47203635907874, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 113.62273861848104, Y: 27.256115263042602, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 126.32319499785586, Y: 15.216655134611415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 143.68224544546638, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.00057624727452, Y: 21.461615323025626, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 166.3664410248457, Y: 37.33594140343041, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.93715900661013, Y: 54.4966586748003, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 150.03618023514957, Y: 66.32099540743832, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 146.28193203764013, Y: 85.96547606922968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.5276838401307, Y: 105.60995673102116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 138.77343564262125, Y: 125.25443739281249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 135.0191874451118, Y: 144.89891805460397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 131.26493924760237, Y: 164.54339871639533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.93608178524352, Y: 175.46813494733013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 154.22440570776672, Y: 190.29975787640578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 158.08437594527425, Y: 207.36875403217184, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.3968385519489, Y: 212.5676758497984, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 196.70930115862353, Y: 217.76659766742495, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 216.02176376529818, Y: 222.9655194850515, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 235.33422637197282, Y: 228.16444130267803, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 252.68967773099564, Y: 225.92040287078365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 266.573130359577, Y: 236.57390668263636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 285.8856111868148, Y: 241.77276081576738, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 304.1151810033363, Y: 242.93868102240876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 314.2219856441751, Y: 258.1547608584114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 328.36412126790606, Y: 272.29689648214236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 343.13887034679044, Y: 281.67554561105885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 345.3379500732246, Y: 299.0368911287342, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.11683402003234, Y: 317.8530207104445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 361.26380480722503, Y: 332.7722759537478, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 355.46897579812156, Y: 349.2850349101378, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 339.0048287710115, Y: 355.2165704841936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 324.0102496288096, Y: 346.1936082242242, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 321.54062344975307, Y: 328.86870712400696, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 314.7617395029454, Y: 310.0525775422967, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 305.38315087934325, Y: 295.2778668707051, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 291.2410152556123, Y: 281.13573124697416, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 277.43747322047693, Y: 273.15554216002874, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 258.12499239323915, Y: 267.9566880268977, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 240.7694713041946, Y: 270.20076639623574, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 226.88597841832967, Y: 259.54719303852437, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 207.57351581165503, Y: 254.3482712208978, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 188.26105320498039, Y: 249.14934940327126, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 168.94859059830574, Y: 243.95042758564472, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 149.6361279916311, Y: 238.75150576801818, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 137.72883332542693, Y: 251.5759485914778, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 122.25, Y: 259.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 122.25, Y: 279.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 122.25, Y: 299.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 122.25, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 139.75, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 157.25, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 174.75, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.25, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.25, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.75, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 297.25, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 314.75, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.25, Y: 319.74024396117466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 339.74024396117466, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 63.81480957513783, Y: 315.09539474366306, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 30.41141331393088, Y: 203.3731712847346, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 86.91539412589945, Y: 47.17196251681821, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 154.66791630441267, Y: 129.0086855903219, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 254.13856570638245, Y: 206.60793115379778, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 365.91961596755857, Y: 363.3684229534381, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 217.93707352182105, Y: 278.859660200362, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 136.0, Y: 339.74024396117466, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 311.0, Y: 339.74024396117466, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '93', X: 363.5, Y: 339.74024396117466, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'KRAS, -12.4 ± 0.8
 kcal/mol, AUC: 0.742', X: 120.0, Y: 376.1684229534381, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 383.91961596755857, 376.1684229534381)
Updated viewBox: -0.25 0.0 389.16961596755857 381.1684229534381
Updated SVG: /disk1/www/rails/humanrnamap/public/result/0bffa335-0463-42d6-94fc-b91dd17f557f/final_image/KRAS_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/0bffa335-0463-42d6-94fc-b91dd17f557f/final_image/KRAS_fold_final_1.svg
