Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 39% [====================                              ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 56% [=============================                     ] \                     
 62% [================================                  ] |                     
 68% [===================================               ] /                     
 73% [=====================================             ] -                     
 79% [========================================          ] \                     
 85% [===========================================       ] |                     
 90% [==============================================    ] /                     
 96% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/0d6337b0-cbae-48f9-83f2-3e9338ee3b31/final_image/FLNB_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.08 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.08 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.08 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.75 MB
Based on canonical annotations, the following gene is in your area of interest: FLNB(+)
write fasta - Elapsed time since the previous call: 0.57 seconds
write fasta - Current memory usage: 172.75 MB
Length of region: 88 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.12 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/0d6337b0-cbae-48f9-83f2-3e9338ee3b31/fasta/FLNB.fasta" "/disk1/www/rails/humanrnamap/public/result/0d6337b0-cbae-48f9-83f2-3e9338ee3b31/ct/FLNB.ct" --SHAPE "FLNB.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.12 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/0d6337b0-cbae-48f9-83f2-3e9338ee3b31/ct/FLNB.ct" "/disk1/www/rails/humanrnamap/public/result/0d6337b0-cbae-48f9-83f2-3e9338ee3b31/fold_FE/FLNB.txt" -sh "FLNB.dat"

efn2 - Elapsed time since the previous call: 0.53 seconds
efn2 - Current memory usage: 176.12 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/0d6337b0-cbae-48f9-83f2-3e9338ee3b31/ct/FLNB.ct" 1 "/disk1/www/rails/humanrnamap/public/result/0d6337b0-cbae-48f9-83f2-3e9338ee3b31/fold_dbn/FLNB_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.12 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CACUGCUUUACCGCUCCUCAUCGCCAACACCCCCAUGCUCUGUGGCCUUCUUACACUUCUCAGAGGGCAGAGUGGCAGCCGGGCACCC', '-structureDBN', '............((........)).....(((...((((((.(.(((((((..........)))))))).)).))))...))).....', '-o', '/disk1/www/rails/humanrnamap/public/result/0d6337b0-cbae-48f9-83f2-3e9338ee3b31/final_image/FLNB_fold_1.svg', '-title', 'FLNB, -23.3 ± 0.7\n kcal/mol, AUC: 0.717', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,5,7,8,9,13,15,18,21,23,36,37,39,41,42,43,44,45,48,49,51,52,57,58,60,63,65,66,67,70,72,73,74,75,78,81,82,83', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '32,1,68,46,47,79,80,25,29,31', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,71,12,14,16,17,87,88,24,27,30,33,34,38,40,50,53,59', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '2,3,69,6,10,11,76,77,19,20,84,22,85,86,26,28,35,54,55,56,61,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.25, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 434.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 203.0949319257163, Y: 421.25759969828727, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 200.4117893094517, Y: 403.96450122649753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 207.56324539329538, Y: 387.9924260659215, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 222.24999272779968, Y: 378.4766516998143, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 239.75000727220032, Y: 378.4766516998143, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 254.43675460670465, Y: 387.9924260659215, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 261.5882106905483, Y: 403.96450122649753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 258.9050680742837, Y: 421.25759969828727, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 434.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 454.3117138864674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.75, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.25, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 434.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 414.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 339.7402137466486, Y: 402.07425523279346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 335.148907661438, Y: 385.1872763781603, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 339.7402137466486, Y: 368.3002975235271, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 352.25, Y: 356.06283886985307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 336.06283886985307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 316.06283886985307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 352.25, Y: 296.06283886985307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 348.43439675932206, Y: 278.98373726669723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 339.92290491375286, Y: 260.88527029949785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 326.99560527811616, Y: 249.08983370352166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 326.15508320820874, Y: 231.61010478659557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 315.43379796682416, Y: 217.77879306683417, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 319.24942460356243, Y: 200.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.24942460356243, Y: 180.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.24942460356243, Y: 160.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.24942460356243, Y: 140.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.24942460356243, Y: 120.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.24942460356243, Y: 100.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.24942460356243, Y: 80.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 305.9494973210245, Y: 69.32609639184466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.5155227424266, Y: 53.051788915627185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 301.4424407616176, Y: 35.65822402352319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 311.28253020968793, Y: 21.186812469618417, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 326.7494372791642, Y: 13.000000000000114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 344.2494119279606, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 359.71631899743693, Y: 21.186812469618303, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.55640844550726, Y: 35.65822402352319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 371.4833264646983, Y: 53.05178891562707, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 365.04935188610034, Y: 69.32609639184466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 351.74942460356243, Y: 80.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 351.74942460356243, Y: 100.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 351.74942460356243, Y: 120.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 351.74942460356243, Y: 140.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 351.74942460356243, Y: 160.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 351.74942460356243, Y: 180.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 351.74942460356243, Y: 200.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 355.5650435555565, Y: 217.77882746425712, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 368.49241872885295, Y: 229.57429147076562, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.33291373545194, Y: 247.05409605044792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 377.84440558102114, Y: 265.15256301764737, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 388.5656344922436, Y: 278.9838771501934, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 384.75, Y: 296.06283886985307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 384.75, Y: 316.06283886985307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 384.75, Y: 336.06283886985307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 384.75, Y: 356.06283886985307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 397.2597862533514, Y: 368.30029752352704, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 401.851092338562, Y: 385.1872763781602, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 397.2597862533514, Y: 402.0742552327934, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 384.75, Y: 414.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 384.75, Y: 434.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 384.75, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 437.25, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 454.75, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 472.25, Y: 454.31171388646743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 474.3117138864674, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 474.3117138864674, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 265.8743963445626, Y: 374.9795271405293, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 334.35786437626905, Y: 468.4538495101984, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 325.16559856551055, Y: 274.6229440969562, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 295.49942460356243, Y: 100.6997961851273, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 387.5564928051897, Y: 55.705479974738694, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 382.84087078089516, Y: 221.06276791032536, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 410.75646948723045, Y: 412.2010472929789, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '88', X: 468.5, Y: 474.31171388646743, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'FLNB, -23.3 ± 0.7
 kcal/mol, AUC: 0.717', X: 172.5, Y: 487.11171388646744, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 486.5, 487.11171388646744)
Updated viewBox: -0.25 0.0 491.75 492.11171388646744
Updated SVG: /disk1/www/rails/humanrnamap/public/result/0d6337b0-cbae-48f9-83f2-3e9338ee3b31/final_image/FLNB_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/0d6337b0-cbae-48f9-83f2-3e9338ee3b31/final_image/FLNB_fold_final_1.svg
