Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 57% [=============================                     ] \                     
 63% [================================                  ] |                     
 68% [===================================               ] /                     
 74% [======================================            ] -                     
 80% [=========================================         ] \                     
 86% [============================================      ] |                     
 91% [==============================================    ] /                     
 97% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/12d1bf78-d1c7-439d-b584-d04e4daee374/final_image/ADAR_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.17 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.17 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.17 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.74 MB
Based on canonical annotations, the following gene is in your area of interest: ADAR(-)
write fasta - Elapsed time since the previous call: 1.03 seconds
write fasta - Current memory usage: 172.74 MB
Length of region: 87 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 176.42 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/12d1bf78-d1c7-439d-b584-d04e4daee374/fasta/ADAR.fasta" "/disk1/www/rails/humanrnamap/public/result/12d1bf78-d1c7-439d-b584-d04e4daee374/ct/ADAR.ct" --SHAPE "ADAR.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.42 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/12d1bf78-d1c7-439d-b584-d04e4daee374/ct/ADAR.ct" "/disk1/www/rails/humanrnamap/public/result/12d1bf78-d1c7-439d-b584-d04e4daee374/fold_FE/ADAR.txt" -sh "ADAR.dat"

efn2 - Elapsed time since the previous call: 0.52 seconds
efn2 - Current memory usage: 176.42 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/12d1bf78-d1c7-439d-b584-d04e4daee374/ct/ADAR.ct" 1 "/disk1/www/rails/humanrnamap/public/result/12d1bf78-d1c7-439d-b584-d04e4daee374/fold_dbn/ADAR_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.42 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCAGGAACUGAGUAUCUACCAAGAUCAGGAACAAAGGAUCUUAAAGUUCCUGGAAGAGCUUGGGGAAGGGAAGGCCACCACAGCACA', '-structureDBN', '(((((((((...........((((((..........))))))..)))))))))....((((((((.........)).))).)))...', '-o', '/disk1/www/rails/humanrnamap/public/result/12d1bf78-d1c7-439d-b584-d04e4daee374/final_image/ADAR_fold_1.svg', '-title', 'ADAR, -29.5 ± 0.7\n kcal/mol, AUC: 0.799', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,5,9,10,12,13,15,17,23,25,28,29,36,37,39,41,42,46,47,48,51,52,53,56,58,60,61,62,63,64,65,68,69,70,73,74,83', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,2,3,66,67,6,7,38,76,49,50,55,24', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '71,8,40,72,43,75,45,77,79,21,22,54,26,30,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '11,14,78,16,80,18,19,20,81,82,84,85,86,87,27,32,33,34,35,44,57,59']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 40.70332757804593, Y: 275.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 40.70332757804593, Y: 255.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 40.70332757804593, Y: 235.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 40.70332757804593, Y: 215.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 40.70332757804593, Y: 195.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 40.70332757804593, Y: 175.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 40.70332757804593, Y: 155.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 40.70332757804593, Y: 135.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 40.70332757804593, Y: 115.11667668033911, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 24.97802886798641, Y: 106.83246630334091, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 12.918767633619666, Y: 93.77538471623805, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 5.90816437882998, Y: 77.44245469450297, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 4.75, Y: 59.70628215467437, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 9.577060559718262, Y: 42.600357817071995, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 19.835913076175103, Y: 28.08591307617519, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 34.350357817071995, Y: 17.827060559718348, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 51.45628215467431, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 69.19245469450294, Y: 14.158164378830065, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 85.52538471623801, Y: 21.168767633619723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 98.58246630334087, Y: 33.228028867986495, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 106.86667668033903, Y: 48.953327578046014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 126.86667668033903, Y: 48.953327578046014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 146.86667668033903, Y: 48.953327578046014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 166.86667668033903, Y: 48.953327578046014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 186.86667668033903, Y: 48.953327578046014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 206.86667668033903, Y: 48.953327578046014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 218.24037647362172, Y: 35.65340029550805, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 234.51468394983922, Y: 29.21942571691011, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 251.9082488419432, Y: 31.14634373610113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 266.37966039584796, Y: 40.98643318417146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 274.56647286546627, Y: 56.45334025364778, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 274.56647286546627, Y: 73.95331490244419, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 266.37966039584796, Y: 89.42022197192048, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 251.9082488419432, Y: 99.26031141999081, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 234.51468394983925, Y: 101.18722943918183, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 218.2403764736217, Y: 94.7532548605839, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 206.86667668033903, Y: 81.45332757804599, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 186.86667668033903, Y: 81.45332757804599, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 166.86667668033903, Y: 81.45332757804599, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 146.86667668033903, Y: 81.45332757804599, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 126.86667668033903, Y: 81.45332757804599, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 106.86667668033903, Y: 81.45332757804599, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 99.41421271102867, Y: 96.06557234946578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 87.81557234946573, Y: 107.66421271102868, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 73.20332757804593, Y: 115.11667668033911, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 73.20332757804593, Y: 135.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.20332757804593, Y: 155.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.20332757804593, Y: 175.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 73.20332757804593, Y: 195.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 73.20332757804593, Y: 215.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.20332757804593, Y: 235.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 73.20332757804593, Y: 255.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 73.20332757804593, Y: 275.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 90.70332757804593, Y: 275.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 108.20332757804593, Y: 275.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 125.70332757804593, Y: 275.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.20332757804593, Y: 275.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 160.70332757804593, Y: 275.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 160.70332757804593, Y: 255.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 160.70332757804593, Y: 235.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 156.88772433736796, Y: 218.03757507718325, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 148.3762324917988, Y: 199.93910810998383, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 139.86474064622962, Y: 181.8406411427844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 128.81184222243246, Y: 166.1101756337842, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 114.66970659870151, Y: 151.96804001005327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 97.1721252982135, Y: 152.25808263629904, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 81.90515660683573, Y: 143.70418626863605, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 73.0159838021359, Y: 128.62996712002294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 72.91929899178052, Y: 111.13024917544809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 81.64136604234356, Y: 95.95872906513253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 96.8128861526591, Y: 87.23666201456948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 114.31260409723393, Y: 87.33334682492486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 129.38682324584704, Y: 96.22251962962471, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 137.94071961351008, Y: 111.48948832100243, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 137.65067698726432, Y: 128.98706962149046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 151.79281261099527, Y: 143.1292052452214, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 166.03187515434706, Y: 151.70613979333896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 169.2747494679287, Y: 168.00946689373447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.7862413134979, Y: 186.1079338609339, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 186.29773315906706, Y: 204.20640082813335, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.0189620702895, Y: 218.03771496067938, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 193.20332757804593, Y: 235.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 193.20332757804593, Y: 255.11667668033908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 193.20332757804593, Y: 275.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 210.70332757804593, Y: 275.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 228.20332757804593, Y: 275.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 245.7033275780459, Y: 275.1166766803391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 41.45332757804593, Y: 295.1166766803391, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 9.04509487229609, Y: 122.69361756220775, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 110.69361756220772, Y: 21.045094872296204, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 277.530061468343, Y: 27.64559183593599, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 143.11667668033903, Y: 101.45332757804599, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 89.45332757804593, Y: 215.11667668033908, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 136.95332757804593, Y: 235.11667668033908, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 63.74923041861261, Y: 81.81659344140158, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 201.4705392037548, Y: 197.73126288403296, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '87', X: 241.9533275780459, Y: 295.1166766803391, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ADAR, -29.5 ± 0.7
 kcal/mol, AUC: 0.799', X: 73.65823643273313, Y: 307.9166766803391, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 295.530061468343, 307.9166766803391)
Updated viewBox: -0.25 0.0 300.780061468343 312.9166766803391
Updated SVG: /disk1/www/rails/humanrnamap/public/result/12d1bf78-d1c7-439d-b584-d04e4daee374/final_image/ADAR_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/12d1bf78-d1c7-439d-b584-d04e4daee374/final_image/ADAR_fold_final_1.svg
