Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  4% [===                                               ] -                     
  8% [=====                                             ] \                     
 12% [=======                                           ] |                     
 16% [=========                                         ] /                     
 21% [===========                                       ] -                     
 25% [=============                                     ] \                     
 29% [===============                                   ] |                     
 33% [=================                                 ] /                     
 38% [====================                              ] -                     
 42% [======================                            ] \                     
 46% [========================                          ] |                     
 50% [==========================                        ] /                     
 55% [============================                      ] -                     
 59% [==============================                    ] \                     
 63% [================================                  ] |                     
 67% [==================================                ] /                     
 72% [=====================================             ] -                     
 76% [=======================================           ] \                     
 80% [=========================================         ] |                     
 84% [===========================================       ] /                     
 88% [=============================================     ] -                     
 93% [===============================================   ] \                     
 97% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/16a652b5-872f-4464-ba18-5e306196cc86/final_image/NORAD_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.09 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.09 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.09 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 170.69 MB
Based on canonical annotations, the following gene is in your area of interest: NORAD(-)
write fasta - Elapsed time since the previous call: 0.27 seconds
write fasta - Current memory usage: 170.69 MB
Length of region: 118 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 174.07 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/16a652b5-872f-4464-ba18-5e306196cc86/fasta/NORAD.fasta" "/disk1/www/rails/humanrnamap/public/result/16a652b5-872f-4464-ba18-5e306196cc86/ct/NORAD.ct" --SHAPE "NORAD.dat"

fold - Elapsed time since the previous call: 0.17 seconds
fold - Current memory usage: 174.07 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/16a652b5-872f-4464-ba18-5e306196cc86/ct/NORAD.ct" "/disk1/www/rails/humanrnamap/public/result/16a652b5-872f-4464-ba18-5e306196cc86/fold_FE/NORAD.txt" -sh "NORAD.dat"

efn2 - Elapsed time since the previous call: 0.40 seconds
efn2 - Current memory usage: 174.07 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/16a652b5-872f-4464-ba18-5e306196cc86/ct/NORAD.ct" 1 "/disk1/www/rails/humanrnamap/public/result/16a652b5-872f-4464-ba18-5e306196cc86/fold_dbn/NORAD_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 174.07 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGUUGGUGUAGUGUAUUCUUGGUUAUCAGAAUACUCAUAUAGCUUUGGGAUUUUGAAUUGGUAAAUAUUCAUGAUGUGUGAAAAAUCAUGAUACAUACUGUACAGUCUCAGUCCCAUA', '-structureDBN', '(((((.......(((((((........))))))).....))))).(((((((..((..(((((.....(((((((.........)))))))....))))).....))..)))))))..', '-o', '/disk1/www/rails/humanrnamap/public/result/16a652b5-872f-4464-ba18-5e306196cc86/final_image/NORAD_fold_1.svg', '-title', 'NORAD, -38.8 ± 1.5\n kcal/mol, AUC: 0.88', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,5,6,7,8,9,11,12,13,14,16,17,19,20,21,22,23,24,26,29,32,35,38,40,42,44,45,46,47,48,49,51,52,53,54,55,58,59,60,61,62,66,68,69,72,73,75,76,77,78,79,80,86,89,90,92,96,99,100,101,105,106,108,111,112,117', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '70,71,74,15,81,18,85,87,88,91,28,30,31,33,113,50,114,115', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,34,97,104,10,107,109,110,83,116,118,56,25,27,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,65,67,82,84,93,94,95,98,36,37,102,39,103,41,43,57']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.5311897717198, Y: 534.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.5311897717198, Y: 514.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.5311897717198, Y: 494.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.5311897717198, Y: 474.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.5311897717198, Y: 454.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 147.25552450812467, Y: 446.2809731881522, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 135.88293032659521, Y: 432.98007636542565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 129.82140427039297, Y: 416.56338800947043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 129.82140051281877, Y: 399.0633950178558, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 135.88291951908343, Y: 382.64670405885715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 147.25550798871168, Y: 369.3458023523166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.5311695856104, Y: 360.8074232623717, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.8186835364903, Y: 358.0886705879441, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 186.74613257512678, Y: 339.32672906215595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 193.67358161376325, Y: 320.56478753636776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 200.60103065239974, Y: 301.8028460105796, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 207.52847969103624, Y: 283.04090448479144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.4559287296727, Y: 264.2789629590033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 221.38337776830917, Y: 245.51702143321512, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.9713780230276, Y: 229.2340005734133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 218.44418269861458, Y: 212.08202877016407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 230.68522957788855, Y: 199.57573913839673, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 247.7588264118068, Y: 195.7361037120773, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.1755388909312, Y: 201.797626658664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 274.6571315264124, Y: 215.8114314552942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 275.83360473407015, Y: 233.27185584434898, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.3267035713125, Y: 248.56509427384145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 251.87153274771498, Y: 256.77412612099937, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.94408370907848, Y: 275.53606764678756, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 238.016634670442, Y: 294.29800917257575, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 231.08918563180552, Y: 313.05995069836393, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 224.16173659316905, Y: 331.82189222415207, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 217.23428755453256, Y: 350.5838337499402, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 210.30683851589606, Y: 369.3457752757284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 221.67944201183212, Y: 382.6466733553402, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.7409740205199, Y: 399.063366984316, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.74097903062082, Y: 416.56336698431534, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 221.67945642185313, Y: 432.98006408401835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 210.3068605417866, Y: 446.28096867538704, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 195.0311897717198, Y: 454.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 195.0311897717198, Y: 474.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 195.0311897717198, Y: 494.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 195.0311897717198, Y: 514.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 195.0311897717198, Y: 534.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.5311897717198, Y: 534.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 230.0311897717198, Y: 534.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 230.0311897717198, Y: 514.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 230.0311897717198, Y: 494.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 230.0311897717198, Y: 474.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 230.0311897717198, Y: 454.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 230.0311897717198, Y: 434.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 230.0311897717198, Y: 414.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 219.65150645431802, Y: 400.72990649702757, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 219.65150645431802, Y: 383.2299029731566, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 230.0311897717198, Y: 369.14046375202554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 230.0311897717198, Y: 349.14046375202554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 217.14049512125376, Y: 338.1848056320936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 210.66650869660987, Y: 322.555219803099, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.03478614919425, Y: 305.6933020525841, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.8926505254633, Y: 291.55116642885315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 183.75051490173234, Y: 277.4090308051222, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 169.6083792780014, Y: 263.26689518139125, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 155.46624365427044, Y: 249.1247595576603, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 138.22033952632006, Y: 252.09587810517786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 121.2831136723658, Y: 247.6937042119743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 107.66654104239592, Y: 236.70108375884246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 99.79207931902073, Y: 221.0728526631312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 99.06005708378956, Y: 203.58820516708528, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 105.6006510642469, Y: 187.35646511875206, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 94.75829314442083, Y: 170.55041636425943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 83.91593522459479, Y: 153.7443676097667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.07357730476875, Y: 136.93831885527396, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 62.231219384942705, Y: 120.13227010078134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 51.388861465116634, Y: 103.32622134628872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 40.54650354529065, Y: 86.52017259179598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 23.381134004146134, Y: 83.1143592369312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 10.260959810933173, Y: 71.53375021875007, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 4.75, Y: 54.92415064336876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 8.345274761357075, Y: 37.79746166147345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 20.070148610254705, Y: 24.806048754492735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 36.73962773811837, Y: 19.478953702032527, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 53.825545061990596, Y: 23.26325090151761, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 66.68661048428402, Y: 35.13095802192299, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 71.82919036172265, Y: 51.85828142695061, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 67.85633277134124, Y: 68.90134097207869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 78.69869069116729, Y: 85.70738972657131, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.54104861099333, Y: 102.51343848106404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 100.38340653081937, Y: 119.31948723555678, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.22576445064541, Y: 136.1255359900494, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 122.06812237047146, Y: 152.93158474454202, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 132.9104802902975, Y: 169.73763349903464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 150.39516622702013, Y: 170.4695882067685, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 166.02345327450323, Y: 178.34401796145374, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.01612593863962, Y: 191.96059417205635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 181.4183310677696, Y: 208.89784867215343, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 178.44721404283322, Y: 226.1437891690975, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.5893496665642, Y: 240.28592479282844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 206.73148529029515, Y: 254.4280604165594, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 220.8736209140261, Y: 268.57019604029034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 235.01575653775706, Y: 282.7123316640213, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 252.76497775018612, Y: 281.4948573192954, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 268.93522807249525, Y: 288.91375898609687, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 279.58863127713425, Y: 303.1623412870556, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.1308067957221, Y: 320.7707041030729, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 275.9426688168848, Y: 337.4507534370131, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 262.5311897717198, Y: 349.14046375202554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.5311897717198, Y: 369.1404637520255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 272.91087308912154, Y: 383.2299029731566, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 272.91087308912154, Y: 400.72990649702757, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.5311897717198, Y: 414.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.5311897717198, Y: 434.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 262.5311897717198, Y: 454.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.5311897717198, Y: 474.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.5311897717198, Y: 494.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.5311897717198, Y: 514.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.5311897717198, Y: 534.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 280.0311897717198, Y: 534.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 297.5311897717198, Y: 534.8193457181586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 163.2811897717198, Y: 554.8193457181586, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 114.88236729956338, Y: 372.526504054825, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 191.29821072942306, Y: 230.9854014387342, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 253.02857619623018, Y: 301.22545821121224, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 209.35805981068725, Y: 463.37660986006057, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 206.2811897717198, Y: 454.8193457181586, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 180.00051490173234, Y: 305.6933020525841, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 74.20224438992815, Y: 181.39277428408553, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 5.4777906904286695, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 135.12417112496414, Y: 142.08922682471592, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '100', X: 236.05654555984745, Y: 265.0012831533598, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '110', X: 274.0297548745851, Y: 417.9807024487242, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '118', X: 289.2811897717198, Y: 554.8193457181586, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'NORAD, -38.8 ± 1.5
 kcal/mol, AUC: 0.88', X: 89.64059488585991, Y: 567.6193457181586, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 0.0, 316.2811897717198, 567.6193457181586)
Updated viewBox: -0.25 -5.0 321.5311897717198 577.6193457181586
Updated SVG: /disk1/www/rails/humanrnamap/public/result/16a652b5-872f-4464-ba18-5e306196cc86/final_image/NORAD_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/16a652b5-872f-4464-ba18-5e306196cc86/final_image/NORAD_fold_final_1.svg
