Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 39% [====================                              ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 56% [=============================                     ] \                     
 62% [================================                  ] |                     
 68% [===================================               ] /                     
 73% [=====================================             ] -                     
 79% [========================================          ] \                     
 85% [===========================================       ] |                     
 90% [==============================================    ] /                     
 96% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/1d6a84c3-19bb-458e-b088-ce4419708037/final_image/MLLT6_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.02 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.02 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.02 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.62 MB
Based on canonical annotations, the following gene is in your area of interest: MLLT6(+)
write fasta - Elapsed time since the previous call: 0.98 seconds
write fasta - Current memory usage: 172.62 MB
Length of region: 88 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.59 seconds
write dat - Current memory usage: 176.23 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/1d6a84c3-19bb-458e-b088-ce4419708037/fasta/MLLT6.fasta" "/disk1/www/rails/humanrnamap/public/result/1d6a84c3-19bb-458e-b088-ce4419708037/ct/MLLT6.ct" --SHAPE "MLLT6.dat"

fold - Elapsed time since the previous call: 0.22 seconds
fold - Current memory usage: 176.23 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/1d6a84c3-19bb-458e-b088-ce4419708037/ct/MLLT6.ct" "/disk1/www/rails/humanrnamap/public/result/1d6a84c3-19bb-458e-b088-ce4419708037/fold_FE/MLLT6.txt" -sh "MLLT6.dat"

efn2 - Elapsed time since the previous call: 0.94 seconds
efn2 - Current memory usage: 176.23 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/1d6a84c3-19bb-458e-b088-ce4419708037/ct/MLLT6.ct" 1 "/disk1/www/rails/humanrnamap/public/result/1d6a84c3-19bb-458e-b088-ce4419708037/fold_dbn/MLLT6_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.23 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAGGGCAGGGAUAGGCGCAGUGGUCAGAUGAAGCAGCGCCAGAGAGGGGACCUCCCAGCUCUUAUUUGCACCCUCCCCACCUCACCAA', '-structureDBN', '..(((.((((...(((((.((..((....)).)).))))).(((..(((....)))..))).........)))).)))..........', '-o', '/disk1/www/rails/humanrnamap/public/result/1d6a84c3-19bb-458e-b088-ce4419708037/final_image/MLLT6_fold_1.svg', '-title', 'MLLT6, -29.8 ± 1.0\n kcal/mol, AUC: 0.585', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,5,8,9,10,12,14,15,17,20,21,22,23,24,27,29,30,33,36,38,42,44,46,47,48,49,53,58,60,62,63,65,66,67,68,74,82', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '64,70,39,40,76,77,16,50,51,52,87,25', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,6,7,72,73,11,75,13,78,81,18,86,26,37,41,43,45,55,56,59', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '2,69,71,79,80,19,83,84,85,88,28,31,32,34,35,54,57,61']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.62857371852382, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 250.12857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.62857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.62857371852385, Y: 390.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.62857371852385, Y: 370.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 260.9501965670346, Y: 354.47286314445876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.6285737185238, Y: 338.297326714376, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.6285737185238, Y: 318.29732671437597, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.6285737185238, Y: 298.29732671437597, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.6285737185238, Y: 278.297326714376, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 253.3897713385113, Y: 272.2682372921287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 241.1470654737858, Y: 262.8231557367201, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 231.70198391837715, Y: 250.58044987199457, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 225.67289449612983, Y: 236.3416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 205.6728944961298, Y: 236.3416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 185.67289449612986, Y: 236.3416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 165.67289449612986, Y: 236.3416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 145.67289449612986, Y: 236.3416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 129.49735806604707, Y: 243.02002464347134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 113.32182163596428, Y: 236.3416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 93.32182163596428, Y: 236.3416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 78.19374517820069, Y: 245.13878251972744, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 60.962817795592855, Y: 242.08208110421072, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 49.78376835165773, Y: 228.6181613354962, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 31.004140721729414, Y: 221.7388019117393, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 13.692687266354653, Y: 219.17660932354875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 4.75, Y: 204.13401659314593, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 10.769451796035924, Y: 187.7018088391103, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 27.312948264886074, Y: 181.99532338992805, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 42.18309978533455, Y: 191.2219070131058, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 60.962727415262805, Y: 198.10126643686272, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 78.1936937064678, Y: 195.04450333329123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 93.32182163596428, Y: 203.8416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 113.32182163596428, Y: 203.8416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 129.49735806604707, Y: 197.16327034049283, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 145.67289449612986, Y: 203.8416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 165.67289449612986, Y: 203.8416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 185.67289449612986, Y: 203.8416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 205.6728944961298, Y: 203.8416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 225.67289449612983, Y: 203.8416474919821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 235.08089839574944, Y: 184.44406024076233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 250.69926914992345, Y: 169.58325866315204, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.61781400082498, Y: 150.53028243187782, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 238.5363588517265, Y: 131.4773062006035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 224.36394906547082, Y: 121.21119459389195, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 219.04267697613233, Y: 104.53983262126837, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 224.64666193085688, Y: 87.96136467943984, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 218.56521434552462, Y: 68.90838603391421, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.4837667601924, Y: 49.855407388388585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 203.89234923301183, Y: 34.60946378130939, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 210.2912741124158, Y: 18.321277510753248, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 226.9626644938489, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 241.61483558186194, Y: 22.568967238118375, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 243.44485705917157, Y: 39.97305506222369, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 249.52630464450385, Y: 59.02603370774932, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 255.60775222983608, Y: 78.07901235327495, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 269.7801535914649, Y: 88.3451235763672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 275.1014235377785, Y: 105.01647883496753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 269.4974452275473, Y: 121.59494158331847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 275.5789003766457, Y: 140.6479178145928, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 281.6603555257442, Y: 159.70089404586713, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 299.0572820291233, Y: 161.59745626104052, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 315.18133729465967, Y: 168.39928261827208, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 328.6803742381011, Y: 179.53597878902235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 338.4223771758808, Y: 194.07363261487365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 343.5903915236736, Y: 210.79313104338542, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 343.75103278752533, Y: 228.29239372454856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 338.890829752351, Y: 245.1039500610952, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 329.41735416450456, Y: 259.8179998192847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 316.12504217437663, Y: 271.20063756091133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 300.1285737185238, Y: 278.297326714376, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 300.1285737185238, Y: 298.29732671437597, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 300.1285737185238, Y: 318.29732671437597, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 300.12857371852385, Y: 338.29732671437597, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 306.8069508700131, Y: 354.47286314445876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 300.12857371852385, Y: 370.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 300.12857371852385, Y: 390.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 300.12857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.62857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 335.12857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.62857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 370.12857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 387.62857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 405.12857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 422.62857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 440.12857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.62857371852385, Y: 410.6483995745415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 475.12857371852385, Y: 410.64839957454154, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 233.37857371852382, Y: 430.6483995745415, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 246.53199735417297, Y: 288.25203858543216, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 109.57182163596428, Y: 256.3416474919821, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 34.311597525098904, Y: 171.65118349252862, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 212.86623300841813, Y: 186.00974118062544, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 180.19051555692357, Y: 35.99666706911944, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 290.88187660792005, Y: 134.56646266549433, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 323.0471187993619, Y: 288.11532882355175, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 331.37857371852385, Y: 430.6483995745415, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '88', X: 471.37857371852385, Y: 430.64839957454154, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'MLLT6, -29.8 ± 1.0
 kcal/mol, AUC: 0.585', X: 173.93928685926193, Y: 443.44839957454155, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 489.37857371852385, 443.44839957454155)
Updated viewBox: -0.25 0.0 494.62857371852385 448.44839957454155
Updated SVG: /disk1/www/rails/humanrnamap/public/result/1d6a84c3-19bb-458e-b088-ce4419708037/final_image/MLLT6_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/1d6a84c3-19bb-458e-b088-ce4419708037/final_image/MLLT6_fold_final_1.svg
