Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 57% [=============================                     ] \                     
 63% [================================                  ] |                     
 68% [===================================               ] /                     
 74% [======================================            ] -                     
 80% [=========================================         ] \                     
 86% [============================================      ] |                     
 91% [==============================================    ] /                     
 97% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/2341c8ff-b69d-460e-9db0-52811bc8145e/final_image/MLLT6_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.41 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.41 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.41 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.02 MB
Based on canonical annotations, the following gene is in your area of interest: MLLT6(+)
write fasta - Elapsed time since the previous call: 1.16 seconds
write fasta - Current memory usage: 172.02 MB
Length of region: 87 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 175.23 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/2341c8ff-b69d-460e-9db0-52811bc8145e/fasta/MLLT6.fasta" "/disk1/www/rails/humanrnamap/public/result/2341c8ff-b69d-460e-9db0-52811bc8145e/ct/MLLT6.ct" --SHAPE "MLLT6.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 175.23 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/2341c8ff-b69d-460e-9db0-52811bc8145e/ct/MLLT6.ct" "/disk1/www/rails/humanrnamap/public/result/2341c8ff-b69d-460e-9db0-52811bc8145e/fold_FE/MLLT6.txt" -sh "MLLT6.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 175.23 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/2341c8ff-b69d-460e-9db0-52811bc8145e/ct/MLLT6.ct" 1 "/disk1/www/rails/humanrnamap/public/result/2341c8ff-b69d-460e-9db0-52811bc8145e/fold_dbn/MLLT6_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.23 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CUGCUGACAAGGUCUCCUCCUCGGCUUCCUCUUCCUCCCACCACGAGGCCAGCACGCAGGAGACCUCUGAGAGCAGCAGGGAGUCAA', '-structureDBN', '(((((..(((((((((((...(((((.((((.............))))..))).)).))))))))).))..)))))...........', '-o', '/disk1/www/rails/humanrnamap/public/result/2341c8ff-b69d-460e-9db0-52811bc8145e/final_image/MLLT6_fold_1.svg', '-title', 'MLLT6, -40.7 ± 1.3\n kcal/mol, AUC: 0.758', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,5,6,11,12,13,15,18,21,23,24,26,27,30,32,33,36,45,47,48,52,56,59,60,62,66,68,69,71,73,76,79,80,81,83,84', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '64,1,65,4,74,14,16,17,19,20,25,28,29,37,39,46,49,50,58', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '34,35,38,8,10,77,63,82,53,22,86,61,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '67,70,7,72,9,75,78,85,87,40,41,42,43,44,51,54,55,57']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 190.03925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 190.03925481335887, Y: 611.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 190.03925481335887, Y: 591.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 190.03925481335887, Y: 571.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 190.03925481335887, Y: 551.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.6595714959571, Y: 536.9751818826314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.6595714959571, Y: 519.4751783587606, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 190.03925481335887, Y: 505.3857391376294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 190.03925481335887, Y: 485.3857391376294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 186.2236515726809, Y: 468.3066375344736, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.71215972711173, Y: 450.2081705672742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 169.20066788154253, Y: 432.10970360007474, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 160.68917603597336, Y: 414.0112366328753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 152.1776841904042, Y: 395.91276966567585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 143.666192344835, Y: 377.8143026984764, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 135.1547004992658, Y: 359.71583573127697, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 126.64320865369666, Y: 341.6173687640775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 118.13171680812746, Y: 323.5189017968781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 102.7427903999336, Y: 315.1863674281254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 95.29523435723968, Y: 299.3502033094322, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 98.69194796940178, Y: 282.1830101305749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 111.60896435730331, Y: 270.37619546115894, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 115.490923545854, Y: 250.7565524252007, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 115.06290363843476, Y: 233.26165778076103, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 110.22615755985794, Y: 213.85532151212516, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 105.38941148128117, Y: 194.4489852434893, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 93.19488088353955, Y: 181.89745758687337, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 91.99374341466745, Y: 164.43880094339335, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 80.77686870266592, Y: 147.8803673914157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 69.55999399066434, Y: 131.3219338394382, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 58.34311927866281, Y: 114.76350028746049, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 40.848284408359746, Y: 115.18770937317515, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 24.540233614471447, Y: 108.83974278602807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 11.936181403831938, Y: 96.6994351968832, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.981614914695911, Y: 80.64069286020697, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 4.75, Y: 63.142248500239816, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 11.277087371502375, Y: 46.905058751630236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 23.555394330836975, Y: 34.435400428326716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.689713854919205, Y: 27.658016421027583, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.18964757074821, Y: 27.619023740108673, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 73.35400895549162, Y: 34.324441065748374, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 85.68776255177698, Y: 46.73925973996563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.28714292076222, Y: 62.94720159675387, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.13350864350156, Y: 80.44650435419032, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 85.25057380062651, Y: 96.53607888045792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 96.4674485126281, Y: 113.09451243243564, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 107.68432322462962, Y: 129.65294598441312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 118.9011979366312, Y: 146.21137953639084, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 134.6690600671884, Y: 153.80246139813755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 141.80217913321556, Y: 169.78271835445338, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 136.9247079178145, Y: 186.589272865802, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 141.76145399639128, Y: 205.99560913443787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 146.59820007496805, Y: 225.40194540307374, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 154.4309044328886, Y: 241.0511863572354, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 147.37284347928622, Y: 257.0647361065956, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 143.4908842907355, Y: 276.68437914255395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 150.9384365122414, Y: 292.5205392171409, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 147.54172562982657, Y: 309.68772754782816, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 156.05321747539574, Y: 327.7861945150276, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 164.56470932096494, Y: 345.88466148222705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 173.0762011665341, Y: 363.9831284494265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 181.58769301210327, Y: 382.08159541662593, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 190.09918485767247, Y: 400.1800623838254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 198.61067670324164, Y: 418.2785293510248, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 207.1221685488108, Y: 436.37699631822426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 215.63366039438, Y: 454.4754632854237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 226.35488930560243, Y: 468.3067774179697, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 222.53925481335887, Y: 485.3857391376294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 222.53925481335887, Y: 505.3857391376294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.91893813076064, Y: 519.4751783587606, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 232.91893813076064, Y: 536.9751818826314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 222.53925481335887, Y: 551.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 222.53925481335887, Y: 571.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 222.53925481335887, Y: 591.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 222.53925481335887, Y: 611.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 222.53925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 240.03925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 257.53925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 275.03925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 292.53925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 310.03925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 327.53925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 345.03925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 362.53925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 380.03925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 397.53925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 415.03925481335887, Y: 631.0646211037625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 190.78925481335887, Y: 651.0646211037625, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 162.9548533788694, Y: 463.9458443647326, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 71.69420509711418, Y: 301.7867248696982, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 49.25156043868668, Y: 142.53880855143973, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 57.32473540566912, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 158.00501564681974, Y: 168.41001479527404, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 178.9131762881644, Y: 337.3731696366579, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 248.16952049297112, Y: 513.231952438064, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 288.78925481335887, Y: 651.0646211037625, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '87', X: 411.28925481335887, Y: 651.0646211037625, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'MLLT6, -40.7 ± 1.3
 kcal/mol, AUC: 0.758', X: 143.89462740667943, Y: 663.8646211037625, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 429.28925481335887, 663.8646211037625)
Updated viewBox: -0.25 -5.0 434.53925481335887 673.8646211037625
Updated SVG: /disk1/www/rails/humanrnamap/public/result/2341c8ff-b69d-460e-9db0-52811bc8145e/final_image/MLLT6_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/2341c8ff-b69d-460e-9db0-52811bc8145e/final_image/MLLT6_fold_final_1.svg
