Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 53% [===========================                       ] -                     
 59% [==============================                    ] \                     
 65% [=================================                 ] |                     
 71% [====================================              ] /                     
 77% [=======================================           ] -                     
 83% [==========================================        ] \                     
 89% [=============================================     ] |                     
 95% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/281aec7c-a4c0-4792-8045-0b9269ba9a80/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.98 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.98 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.98 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.54 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.33 seconds
write fasta - Current memory usage: 172.54 MB
Length of region: 84 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.19 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/281aec7c-a4c0-4792-8045-0b9269ba9a80/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/281aec7c-a4c0-4792-8045-0b9269ba9a80/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 176.19 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/281aec7c-a4c0-4792-8045-0b9269ba9a80/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/281aec7c-a4c0-4792-8045-0b9269ba9a80/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 176.19 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/281aec7c-a4c0-4792-8045-0b9269ba9a80/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/281aec7c-a4c0-4792-8045-0b9269ba9a80/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.19 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CACAUGCCUUCUAAACGUGAACUAAGAUUUCCUUUGGCAAUAUCAUAUUCUAAAAGUAAUAAAUUCCAAUACAAGUUACAUACA', '-structureDBN', '(((.............))).............(((((.((((...))))))))).(((((..............))))).....', '-o', '/disk1/www/rails/humanrnamap/public/result/281aec7c-a4c0-4792-8045-0b9269ba9a80/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -4.2 ± 0.6\n kcal/mol, AUC: 0.61', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,6,9,10,12,17,18,19,23,26,28,29,30,33,34,35,36,37,41,43,46,48,49,51,56,57,60,64,65,70,75,76,77,81', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,2,69,7,13,47,52,61', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '3,67,68,8,74,15,80,82,20,21,84,25,27,45,50,54,59,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '66,4,71,72,73,11,14,78,16,79,83,22,24,31,32,38,39,40,42,44,53,55,58,63']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 33.0401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 33.0401921120349, Y: 174.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 33.0401921120349, Y: 154.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 18.317924068590344, Y: 145.3135537497214, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 8.376352591146599, Y: 130.91166647594878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 4.75, Y: 113.79153892466401, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 7.998608686482214, Y: 96.5957329799086, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 17.62074257978429, Y: 81.97849179605512, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 32.13118586049046, Y: 72.19604648391643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 49.2901921120349, Y: 68.75835758771981, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 66.44919836357934, Y: 72.19604648391643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 80.95964164428551, Y: 81.97849179605512, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 90.58177553758759, Y: 96.5957329799086, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 93.8303842240698, Y: 113.79153892466404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 90.2040316329232, Y: 130.91166647594883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 80.26246015547946, Y: 145.31355374972134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 65.5401921120349, Y: 154.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 65.5401921120349, Y: 174.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 65.5401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 83.0401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 100.5401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 118.0401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 135.5401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 153.0401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 170.5401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 188.0401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 205.5401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 223.0401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 240.5401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 258.0401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 275.5401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 293.0401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 310.5401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 310.5401921120349, Y: 174.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 310.5401921120349, Y: 154.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 310.5401921120349, Y: 134.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 310.5401921120349, Y: 114.77421039419097, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 306.72457324545223, Y: 97.69517873275598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.4459142045917, Y: 83.86386939975361, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 325.95753221983944, Y: 65.76546176917708, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.4691502350872, Y: 47.66705413860063, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 342.980768250335, Y: 29.56864650802413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 351.2684943696637, Y: 14.155522630516145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 368.7303258699037, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 378.97679242331657, Y: 27.18663861040386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 372.39068065002186, Y: 43.40002578280178, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 363.8790626347741, Y: 61.49843341337828, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 355.3674446195263, Y: 79.59684104395475, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 346.8558266042785, Y: 97.69524867453126, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 343.0401921120349, Y: 114.77421039419097, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 343.0401921120349, Y: 134.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 343.0401921120349, Y: 154.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 343.0401921120349, Y: 174.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 343.0401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 360.5401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 378.0401921120349, Y: 194.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 378.0401921120349, Y: 174.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 378.0401921120349, Y: 154.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 378.0401921120349, Y: 134.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 378.0401921120349, Y: 114.77421039419097, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 363.00116688815893, Y: 105.82560283169063, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.24506518269146, Y: 92.02139575219289, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 347.2442102984878, Y: 75.25114508563601, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 348.6831323173404, Y: 57.8104065572457, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 356.3648678339783, Y: 42.08651402249336, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.2379208215679, Y: 30.231794971806266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 385.54019415500636, Y: 23.86895432050295, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 403.04019006906344, Y: 23.86895432050295, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.3424634025019, Y: 30.231794971806266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 432.2155163900915, Y: 42.08651402249342, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.8972519067295, Y: 57.810406557245756, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 441.336173925582, Y: 75.25114508563601, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 436.33531904137834, Y: 92.02139575219289, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 425.57921733591087, Y: 105.82560283169063, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 410.5401921120349, Y: 114.77421039419097, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 410.5401921120349, Y: 134.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 410.5401921120349, Y: 154.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 410.5401921120349, Y: 174.77421039419096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 410.5401921120349, Y: 194.774210394191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 428.0401921120349, Y: 194.774210394191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 445.5401921120349, Y: 194.774210394191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 463.0401921120349, Y: 194.774210394191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 480.5401921120349, Y: 194.774210394191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 498.0401921120349, Y: 194.774210394191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 33.7901921120349, Y: 214.77421039419096, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 45.5401921120349, Y: 48.758357587719814, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 79.2901921120349, Y: 214.77421039419096, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 254.2901921120349, Y: 214.77421039419096, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 304.10912458926293, Y: 57.25384375392929, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 359.2901921120349, Y: 114.77421039419097, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 356.0611080255697, Y: 123.00224134749814, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 444.50149595456406, Y: 30.134637207205373, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 424.2901921120349, Y: 214.774210394191, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '84', X: 494.2901921120349, Y: 214.774210394191, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -4.2 ± 0.6
 kcal/mol, AUC: 0.61', X: 189.89509605601745, Y: 227.574210394191, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 5.0, 512.2901921120349, 227.574210394191)
Updated viewBox: -0.25 0.0 517.5401921120349 232.574210394191
Updated SVG: /disk1/www/rails/humanrnamap/public/result/281aec7c-a4c0-4792-8045-0b9269ba9a80/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/281aec7c-a4c0-4792-8045-0b9269ba9a80/final_image/CLOCK_fold_final_1.svg
