Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 13% [=======                                           ] \                     
 20% [===========                                       ] |                     
 26% [==============                                    ] /                     
 33% [=================                                 ] -                     
 40% [=====================                             ] \                     
 46% [========================                          ] |                     
 53% [===========================                       ] /                     
 60% [===============================                   ] -                     
 66% [==================================                ] \                     
 73% [=====================================             ] |                     
 80% [=========================================         ] /                     
 86% [============================================      ] -                     
 93% [===============================================   ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/28367036-d231-4291-b114-928331f2dcfd/final_image/ZMIZ1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.56 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.56 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.56 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.13 MB
Based on canonical annotations, the following gene is in your area of interest: ZMIZ1(+)
write fasta - Elapsed time since the previous call: 0.48 seconds
write fasta - Current memory usage: 172.13 MB
Length of region: 75 nt.
94.3% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 175.79 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/28367036-d231-4291-b114-928331f2dcfd/fasta/ZMIZ1.fasta" "/disk1/www/rails/humanrnamap/public/result/28367036-d231-4291-b114-928331f2dcfd/ct/ZMIZ1.ct" --SHAPE "ZMIZ1.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 175.79 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/28367036-d231-4291-b114-928331f2dcfd/ct/ZMIZ1.ct" "/disk1/www/rails/humanrnamap/public/result/28367036-d231-4291-b114-928331f2dcfd/fold_FE/ZMIZ1.txt" -sh "ZMIZ1.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 175.79 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/28367036-d231-4291-b114-928331f2dcfd/ct/ZMIZ1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/28367036-d231-4291-b114-928331f2dcfd/fold_dbn/ZMIZ1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 175.79 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGCAUCCCUCCAUACCUGUCCCCCAGCCAAGACGUCAAACCACCCUUCCCGCCUGACAUCAAGCCAAAUAUGAGC', '-structureDBN', '.......(((.(((.(((.....)))....((.((((................)))).))........)))))).', '-o', '/disk1/www/rails/humanrnamap/public/result/28367036-d231-4291-b114-928331f2dcfd/final_image/ZMIZ1_fold_1.svg', '-title', 'ZMIZ1, -1.7 ± 0.9\n kcal/mol, AUC: 0.59', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,5,69,71,72,9,74,13,17,18,19,26,31,34,35,46,47,51,54,55,56,57,58,59,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '66,7,42,20,21,53,25,60,61', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,1,65,67,4,37,6,70,8,10,12,44,16,49', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '3,68,73,11,75,14,15,22,23,24,27,28,29,30,32,33,36,38,39,40,41,43,45,48,50,52,62']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 420.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 420.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 420.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 420.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 420.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 420.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 420.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 420.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 400.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 380.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 123.43438113341733, Y: 362.96608950355403, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 134.15572209255677, Y: 349.1347801705516, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 142.66734010780456, Y: 331.0363725399751, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 151.17895812305235, Y: 312.9379649093986, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 139.63470484159657, Y: 299.5685477703424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 132.44946049345492, Y: 283.4321490977144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 112.44946049345492, Y: 283.4321490977144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.44946049345492, Y: 283.4321490977144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 76.26142019380032, Y: 290.0803187025323, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 60.105653967546885, Y: 283.3540994464929, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 53.41844006680245, Y: 267.1821490977144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 60.105653967546885, Y: 251.01019874893586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 76.26142019380029, Y: 244.2839794928965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.44946049345492, Y: 250.9321490977144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 112.44946049345492, Y: 250.9321490977144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 132.44946049345492, Y: 250.9321490977144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 139.51078432827362, Y: 234.9918010764577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 150.82890971279448, Y: 221.7306915030009, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 165.461816490317, Y: 212.25255726786276, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 182.19159156417246, Y: 207.34627401909222, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 199.62579715856165, Y: 207.4201971651869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 207.8037260458468, Y: 189.16858137056454, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 208.3232702539147, Y: 171.67636955572857, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 221.03188968791676, Y: 159.6456425435763, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.20975460864213, Y: 141.39399808784657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 237.3876195293675, Y: 123.14235363211685, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 245.5654844500928, Y: 104.89070917638719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 234.6918893550735, Y: 91.17886407005199, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 228.8946522207227, Y: 74.66699536543047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 228.80999389672724, Y: 57.16720681017273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 234.44720525554544, Y: 40.6000219374622, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 245.1876275607042, Y: 26.783615197017753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 259.85254749642525, Y: 17.234275440288457, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 276.83255568271073, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 294.2641721573635, Y: 14.545481669632409, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 310.23435496817393, Y: 21.701110747487746, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 322.9904479718658, Y: 33.68158894294038, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 331.1325270077722, Y: 49.1721123519028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 333.7670353138712, Y: 66.47266530536785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 330.6048473853459, Y: 83.68458948644775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 321.99299920574003, Y: 98.91895318966726, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 308.876602599743, Y: 110.50385312815376, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 292.6951234370622, Y: 117.16789834245714, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 275.2244066906536, Y: 118.17973967256574, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.0465417699283, Y: 136.43138412829546, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 258.8686768492029, Y: 154.68302858402518, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 250.69081192847761, Y: 172.93467303975495, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 250.17129616793085, Y: 190.4269600078602, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 237.46260171210804, Y: 202.4577158124029, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.2846728248229, Y: 220.7093316070252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 240.98093167956392, Y: 233.72653287315347, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 248.4569201528297, Y: 249.54928852277396, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 251.08570935796263, Y: 266.85071815488755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 248.64685167181233, Y: 284.1799412530736, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 241.34486725105933, Y: 300.08374656875446, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.7920931772366, Y: 313.22845695731803, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.95733348392568, Y: 322.51177020430674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 198.08461622328556, Y: 327.1551969822906, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 180.58887052273914, Y: 326.7693441841763, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 172.07725250749135, Y: 344.8677518147528, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 163.56563449224356, Y: 362.96615944532925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 159.75, Y: 380.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 400.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 159.75, Y: 420.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.25, Y: 420.045121164989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 440.045121164989, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 103.62066062619364, Y: 377.851524561, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 42.19646530385707, Y: 297.47916144232283, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 175.640551986223, Y: 187.54339096427515, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 205.3204706636636, Y: 53.94987522462844, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 345.65529218778863, Y: 90.50685269086199, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 245.4662764741792, Y: 219.05670461796643, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 186.42566013806783, Y: 353.37936983000066, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '75', X: 173.5, Y: 440.045121164989, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ZMIZ1, -1.7 ± 0.9
 kcal/mol, AUC: 0.59', X: 107.7585176569356, Y: 452.845121164989, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 5.0, 363.65529218778863, 452.845121164989)
Updated viewBox: -0.25 0.0 368.90529218778863 457.845121164989
Updated SVG: /disk1/www/rails/humanrnamap/public/result/28367036-d231-4291-b114-928331f2dcfd/final_image/ZMIZ1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/28367036-d231-4291-b114-928331f2dcfd/final_image/ZMIZ1_fold_final_1.svg
