Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 46% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 63% [================================                  ] |                     
 69% [===================================               ] /                     
 75% [======================================            ] -                     
 81% [=========================================         ] \                     
 87% [============================================      ] |                     
 93% [===============================================   ] /                     
 98% [==================================================] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/2d770ecc-246d-4bcd-9359-3d539861028c/final_image/CALD1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.07 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.07 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.07 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.55 MB
Based on canonical annotations, the following gene is in your area of interest: CALD1(+)
write fasta - Elapsed time since the previous call: 0.41 seconds
write fasta - Current memory usage: 171.55 MB
Length of region: 86 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 174.94 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/2d770ecc-246d-4bcd-9359-3d539861028c/fasta/CALD1.fasta" "/disk1/www/rails/humanrnamap/public/result/2d770ecc-246d-4bcd-9359-3d539861028c/ct/CALD1.ct" --SHAPE "CALD1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 174.94 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/2d770ecc-246d-4bcd-9359-3d539861028c/ct/CALD1.ct" "/disk1/www/rails/humanrnamap/public/result/2d770ecc-246d-4bcd-9359-3d539861028c/fold_FE/CALD1.txt" -sh "CALD1.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 174.94 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/2d770ecc-246d-4bcd-9359-3d539861028c/ct/CALD1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/2d770ecc-246d-4bcd-9359-3d539861028c/fold_dbn/CALD1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 174.94 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAACCCAUGCUGUGAAAUAGAGACUUUUCUACUGAUCAUCAUAACUCUGUAUCUGAGCAGUGAUACCAACCACAUCUGAAGUCAAC', '-structureDBN', '.......((((..((.((((((......................)))))).))..)))).((((..((........))..))))..', '-o', '/disk1/www/rails/humanrnamap/public/result/2d770ecc-246d-4bcd-9359-3d539861028c/final_image/CALD1_fold_1.svg', '-title', 'CALD1, -12.4 ± 1.3\n kcal/mol, AUC: 0.605', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '8,9,11,12,13,14,18,20,22,25,26,27,28,30,33,34,36,39,42,46,48,49,50,52,54,55,57,60,61,62,64,75,77,78,81,82', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,2,3,67,37,68,71,19,23,58', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '65,4,38,7,40,72,10,74,76,15,47,21,24,59,29', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '66,5,6,69,70,73,79,16,17,80,83,84,85,86,31,32,35,41,43,44,45,51,53,56,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 387.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 367.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 347.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 116.87031668259823, Y: 333.3624886969134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 116.87031668259823, Y: 315.8624851730425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 301.7730459519114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 281.7730459519114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 120.57162284851074, Y: 265.59750952182867, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 249.42197309174585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 229.42197309174585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 209.42197309174585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 189.42197309174585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 169.42197309174583, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 149.42197309174583, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 110.887168041043, Y: 143.21643324138017, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 96.59496185945059, Y: 133.1177285217443, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 85.28080987395873, Y: 119.7670371763221, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 77.66306045675607, Y: 104.01200977652843, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.22537317867092, Y: 86.85295092326862, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 75.18601071316505, Y: 69.37930877061876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 80.4839810910611, Y: 52.70050472397088, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.78291015000502, Y: 37.87549501374565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 102.49239831244513, Y: 25.8455363604362, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 117.80550572601359, Y: 17.374424515344117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 134.74998579213235, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 152.25001420786762, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 169.1944942739865, Y: 17.37442451534423, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 184.50760168755485, Y: 25.8455363604362, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.21708984999498, Y: 37.87549501374565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 206.5160189089389, Y: 52.70050472397077, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 211.81398928683495, Y: 69.37930877061865, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.7746268213291, Y: 86.85295092326862, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.33693954324394, Y: 104.01200977652843, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 201.7191901260413, Y: 119.7670371763221, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 190.40503814054938, Y: 133.11772852174443, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 176.11283195895703, Y: 143.21643324138017, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 149.42197309174583, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 169.42197309174583, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 189.42197309174585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 209.42197309174585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 159.75, Y: 229.42197309174585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 249.42197309174585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 166.42837715148926, Y: 265.59750952182867, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 281.7730459519114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 301.7730459519114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 170.12968331740177, Y: 315.8624851730425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 170.12968331740177, Y: 333.3624886969134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 347.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 159.75, Y: 367.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 387.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.25, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 387.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 367.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 347.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 184.37031668259823, Y: 333.3624886969134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 184.37031668259823, Y: 315.8624851730425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 301.7730459519114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 281.7730459519114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 183.0949319257163, Y: 268.71893176373123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 180.4117893094517, Y: 251.42583329194153, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 187.56324539329538, Y: 235.4537581313655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 202.24999272779968, Y: 225.93798376525834, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 219.7500072722003, Y: 225.93798376525828, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 234.43675460670462, Y: 235.4537581313655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 241.5882106905483, Y: 251.42583329194153, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 238.9050680742837, Y: 268.71893176373123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 281.7730459519114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.25, Y: 301.7730459519114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 237.62968331740177, Y: 315.8624851730425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 237.62968331740177, Y: 333.3624886969134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.25, Y: 347.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 367.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.25, Y: 387.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 407.4519279180445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 407.45192791804453, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.25, Y: 407.45192791804453, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 427.4519279180445, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 103.5, Y: 367.4519279180445, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 103.5, Y: 189.42197309174585, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 70.56398029649255, Y: 25.1982630924187, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 228.97366624099703, Y: 88.27977475000233, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 176.0, Y: 249.42197309174585, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 173.5, Y: 427.4519279180445, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 156.83981339315883, Y: 248.763264837628, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 252.88026567961225, Y: 339.60571461760986, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '86', X: 258.5, Y: 427.45192791804453, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CALD1, -12.4 ± 1.3
 kcal/mol, AUC: 0.605', X: 67.5, Y: 440.25192791804454, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 276.5, 440.25192791804454)
Updated viewBox: -0.25 0.0 281.75 445.25192791804454
Updated SVG: /disk1/www/rails/humanrnamap/public/result/2d770ecc-246d-4bcd-9359-3d539861028c/final_image/CALD1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/2d770ecc-246d-4bcd-9359-3d539861028c/final_image/CALD1_fold_final_1.svg
