Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 16% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 33% [=================                                 ] \                     
 39% [====================                              ] |                     
 44% [=======================                           ] /                     
 50% [==========================                        ] -                     
 56% [=============================                     ] \                     
 61% [===============================                   ] |                     
 67% [==================================                ] /                     
 73% [=====================================             ] -                     
 78% [========================================          ] \                     
 84% [===========================================       ] |                     
 89% [=============================================     ] /                     
 95% [================================================  ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/2e5ec8a8-e97f-4cc4-8141-1251b92c7084/final_image/ZBTB20_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.00 MB
setup complete - Elapsed time since the previous call: 0.01 seconds
setup complete - Current memory usage: 159.00 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.00 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.61 MB
Based on canonical annotations, the following gene is in your area of interest: ZBTB20(-)
write fasta - Elapsed time since the previous call: 0.59 seconds
write fasta - Current memory usage: 172.61 MB
Length of region: 89 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.29 seconds
write dat - Current memory usage: 176.29 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/2e5ec8a8-e97f-4cc4-8141-1251b92c7084/fasta/ZBTB20.fasta" "/disk1/www/rails/humanrnamap/public/result/2e5ec8a8-e97f-4cc4-8141-1251b92c7084/ct/ZBTB20.ct" --SHAPE "ZBTB20.dat"

fold - Elapsed time since the previous call: 0.13 seconds
fold - Current memory usage: 176.29 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/2e5ec8a8-e97f-4cc4-8141-1251b92c7084/ct/ZBTB20.ct" "/disk1/www/rails/humanrnamap/public/result/2e5ec8a8-e97f-4cc4-8141-1251b92c7084/fold_FE/ZBTB20.txt" -sh "ZBTB20.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 176.29 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/2e5ec8a8-e97f-4cc4-8141-1251b92c7084/ct/ZBTB20.ct" 1 "/disk1/www/rails/humanrnamap/public/result/2e5ec8a8-e97f-4cc4-8141-1251b92c7084/fold_dbn/ZBTB20_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.29 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAUUGACUGCACCAAACCAAAGCUAUAGAAAGAAAUGAUUGACUUUUUAAAAUAUAUUCACAUUAACUGUCCUAGGAUACUUCUCUUGA', '-structureDBN', '.................(((.....(((((((..........))))))).........................(((....))).))).', '-o', '/disk1/www/rails/humanrnamap/public/result/2e5ec8a8-e97f-4cc4-8141-1251b92c7084/final_image/ZBTB20_fold_1.svg', '-title', 'ZBTB20, 0.1 ± 1.0\n kcal/mol, AUC: 0.751', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,5,8,9,22,24,26,28,32,36,37,39,40,41,44,45,46,47,48,53,55,57,58,63,64,68,69,70,73,75,76,78,81,82,84,86,87,88', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '33,43,13,18,19,20,21,50,83,25', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,35,38,59,77,49,52,85,23,56,27,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,65,66,67,6,7,71,72,10,11,12,74,14,15,16,17,79,80,89,29,30,31,34,42,51,54,60,61']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 144.75, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.25, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.25, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.75, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 302.25, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 267.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 247.53888645405775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 285.1995023386804, Y: 243.598220830442, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 268.98617860005595, Y: 237.01214085807828, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 254.01763145638222, Y: 227.946220471078, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 240.67016991831605, Y: 216.62837674775076, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.2793489330386, Y: 203.34314007928396, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 220.1315335388129, Y: 188.42450108073663, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 201.16531000163044, Y: 194.7713400370696, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 182.199086464448, Y: 201.11817899340255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 163.23286292726553, Y: 207.46501794973554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.26663939008307, Y: 213.81185690606853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 125.30041585290058, Y: 220.1586958624015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 106.33419231571811, Y: 226.50553481873445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 99.76901050916818, Y: 242.72735655846088, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 86.3776728588042, Y: 253.9932869968427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 69.2716689487045, Y: 257.68567686468816, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 52.42559447506764, Y: 252.94659598996205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75365029115224, Y: 240.87717416005455, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 34.200174249361226, Y: 224.28175260584968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 37.0555216010232, Y: 207.0162927449056, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 47.65624977037871, Y: 193.09244000983446, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 63.539269845492214, Y: 185.7454143530088, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 81.0141475458064, Y: 186.68230392365084, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 96.02057901167704, Y: 195.68542157081296, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 114.98680254885952, Y: 189.33858261447998, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 133.95302608604197, Y: 182.991743658147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 152.91924962322443, Y: 176.64490470181403, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 171.8854731604069, Y: 170.29806574548107, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 190.85169669758935, Y: 163.95122678914808, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.8179202347718, Y: 157.60438783281515, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 208.1440585576575, Y: 140.18462356673254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.24455855320033, Y: 122.71926070878399, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 213.09175351883323, Y: 105.64738058688735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 219.5889245092925, Y: 89.39817232553705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 228.57273186256225, Y: 74.38014297946981, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 239.81732157867032, Y: 60.970847617058155, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 253.04000331647717, Y: 49.50739754037215, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 267.9083572629336, Y: 40.27798526640299, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.04859120725865, Y: 33.51463933243974, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 301.0549377221838, Y: 29.387391070668798, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 318.49985520599506, Y: 27.999999999982776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 335.94477632994494, Y: 29.387345299166157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.95113367377286, Y: 33.51454894013557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 369.0913853635247, Y: 40.27785252577053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 383.9597635258097, Y: 49.50722578852708, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 397.1824753410581, Y: 60.97064117186238, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 408.42710024007033, Y: 74.37990703098066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 417.4109469972043, Y: 89.39791280552791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 423.9081606218699, Y: 105.64710401972249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 427.7554003802222, Y: 122.71897404739522, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 428.8559462009032, Y: 140.184334017822, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 427.18213022929626, Y: 157.60410267567713, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 422.7760324007271, Y: 174.54034493673015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 415.74842254581654, Y: 190.56728162866114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 406.27597562358375, Y: 205.28199363078616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 394.5968300916762, Y: 218.3145513093282, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 406.103012395907, Y: 234.67327279915762, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 417.6091947001378, Y: 251.03199428898702, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 430.3705853938324, Y: 263.0068913306935, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 429.1410691402581, Y: 280.4636820259727, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 414.827158587373, Y: 290.53161211515146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 397.98238722463714, Y: 285.78767605595516, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 391.026272279165, Y: 269.729540533362, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 379.52008997493425, Y: 253.37081904353266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 368.0139076707035, Y: 237.01209755370328, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 351.80054367676837, Y: 243.5982062682759, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 247.53888645405775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 267.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.75, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 287.5388864540577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 307.5388864540577, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 307.5388864540577, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 282.3648543932107, Y: 259.35654596208667, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 146.86347834641606, Y: 232.77808044325099, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 31.38225787810591, Y: 177.49918418937526, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 184.396759334702, Y: 140.51329329089884, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 314.7498289682683, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 445.1032462861445, Y: 140.5129512736198, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 414.4456816381401, Y: 310.24589760705936, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '89', X: 348.5, Y: 307.5388864540577, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ZBTB20, 0.1 ± 1.0
 kcal/mol, AUC: 0.751', X: 151.5602926969162, Y: 323.0458976070594, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 463.1032462861445, 323.0458976070594)
Updated viewBox: -0.25 -5.0 468.3532462861445 333.0458976070594
Updated SVG: /disk1/www/rails/humanrnamap/public/result/2e5ec8a8-e97f-4cc4-8141-1251b92c7084/final_image/ZBTB20_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/2e5ec8a8-e97f-4cc4-8141-1251b92c7084/final_image/ZBTB20_fold_final_1.svg
