Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 13% [=======                                           ] \                     
 20% [===========                                       ] |                     
 26% [==============                                    ] /                     
 33% [=================                                 ] -                     
 40% [=====================                             ] \                     
 46% [========================                          ] |                     
 53% [===========================                       ] /                     
 60% [===============================                   ] -                     
 66% [==================================                ] \                     
 73% [=====================================             ] |                     
 80% [=========================================         ] /                     
 86% [============================================      ] -                     
 93% [===============================================   ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/31404726-de1a-4aed-82d7-ce10d1dcf15e/final_image/HCFC1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.98 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.98 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.98 MB
read annotations - Elapsed time since the previous call: 0.11 seconds
read annotations - Current memory usage: 172.69 MB
Based on canonical annotations, the following gene is in your area of interest: HCFC1(-)
write fasta - Elapsed time since the previous call: 0.28 seconds
write fasta - Current memory usage: 172.69 MB
Length of region: 75 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.23 seconds
write dat - Current memory usage: 176.27 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/31404726-de1a-4aed-82d7-ce10d1dcf15e/fasta/HCFC1.fasta" "/disk1/www/rails/humanrnamap/public/result/31404726-de1a-4aed-82d7-ce10d1dcf15e/ct/HCFC1.ct" --SHAPE "HCFC1.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 176.27 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/31404726-de1a-4aed-82d7-ce10d1dcf15e/ct/HCFC1.ct" "/disk1/www/rails/humanrnamap/public/result/31404726-de1a-4aed-82d7-ce10d1dcf15e/fold_FE/HCFC1.txt" -sh "HCFC1.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 176.27 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/31404726-de1a-4aed-82d7-ce10d1dcf15e/ct/HCFC1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/31404726-de1a-4aed-82d7-ce10d1dcf15e/fold_dbn/HCFC1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.27 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACGCCCACAUCGACUACACCACCAAGCCCGCCAUCAUCUUCCGCAUCGCCGCCCGCAAUGAGAAGGGCUAUGGCC', '-structureDBN', '..................(((...(((((....((((.....((......)).....))))...))))).)))..', '-o', '/disk1/www/rails/humanrnamap/public/result/31404726-de1a-4aed-82d7-ce10d1dcf15e/final_image/HCFC1_fold_1.svg', '-title', 'HCFC1, -16.1 ± 0.7\n kcal/mol, AUC: 0.611', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '65,66,3,67,69,71,72,73,10,12,15,26,30,34,37,39,40,43,46,48,51,55,59,60,62', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '4,68,74,75,13,14,16,20,53,28', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '32,2,35,7,41,17,18,19,49,50,52,54,24,27,29', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,5,6,70,8,9,11,21,22,23,25,31,33,36,38,42,44,45,47,56,57,58,61,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 360.5800114022368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 360.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.25, Y: 360.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.75, Y: 360.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 360.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 360.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 340.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 320.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 309.3703161036602, Y: 306.49057041917024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 309.3703178404747, Y: 288.99056513336393, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75000453347, Y: 274.90112621059257, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 336.4635945930745, Y: 269.7140179292144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 348.32609168585145, Y: 253.6118080583967, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 360.1885887786284, Y: 237.50959818757897, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 372.05108587140535, Y: 221.4073883167613, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 383.9135829641823, Y: 205.30517844594365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 380.0328706093963, Y: 188.92159991014708, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 384.01531279799974, Y: 172.56245175892505, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 394.9923042606063, Y: 159.79580644979777, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 410.5696677123043, Y: 153.40618033296553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 427.3498447362983, Y: 154.78720642345903, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 441.49198036002923, Y: 140.64507079972807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 455.6341159837602, Y: 126.5029351759971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.77625160749113, Y: 112.36079955226614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 466.1256795711609, Y: 95.24576683340388, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.3975596159165, Y: 78.05432064255365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 479.07986498224295, Y: 63.47680425760757, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 493.65738136718903, Y: 53.79449889128114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 510.84882755803915, Y: 50.52261884652546, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 527.9638602769015, Y: 54.17319088285569, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 542.1059959006325, Y: 40.03105525912474, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 546.5269381737291, Y: 23.09870689166496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 560.819078354098, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 578.255678764193, Y: 14.487991249216634, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 590.6300302991033, Y: 26.862342784126895, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 592.11802154832, Y: 44.29894319422192, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 582.0193146566552, Y: 58.59108337459077, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 565.0869662891953, Y: 63.01202564768755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 550.9448306654645, Y: 77.1541612714185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 554.5954027017947, Y: 94.26919399028088, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 551.323522657039, Y: 111.460640181131, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 541.6412172907126, Y: 126.03815656607708, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 527.0637009057665, Y: 135.72046193240357, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 509.8722547149164, Y: 138.99234197715924, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 492.7572219960539, Y: 135.341769940829, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 478.615086372323, Y: 149.48390556455993, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 464.47295074859204, Y: 163.62604118829088, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 450.3308151248611, Y: 177.76817681202184, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 451.44458095727884, Y: 196.06102515706928, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 443.42074744046477, Y: 212.53788379574226, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 428.33279377578435, Y: 222.9408847626183, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 410.07967400426105, Y: 224.58173622170617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 398.2171769114841, Y: 240.68394609252383, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 386.35467981870715, Y: 256.78615596334146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 374.4921827259302, Y: 272.88836583415923, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 362.62968563315326, Y: 288.9905757049769, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 362.6296821595253, Y: 306.49057570497655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 352.25, Y: 320.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 340.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 360.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 360.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 387.25, Y: 360.58001140223683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 380.5800114022368, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 380.5800114022368, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 296.0, Y: 340.58001140223683, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 356.2829671397372, Y: 188.85946132053655, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 461.187729358512, Y: 49.33466863387662, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 589.653216070527, Y: 75.0351336238221, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 474.865086372323, Y: 177.76817681202184, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 377.88026369557775, Y: 312.7338041399951, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '75', X: 383.5, Y: 380.58001140223683, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'HCFC1, -16.1 ± 0.7
 kcal/mol, AUC: 0.611', X: 232.43401077416001, Y: 393.38001140223685, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 607.653216070527, 393.38001140223685)
Updated viewBox: -0.25 0.0 612.903216070527 398.38001140223685
Updated SVG: /disk1/www/rails/humanrnamap/public/result/31404726-de1a-4aed-82d7-ce10d1dcf15e/final_image/HCFC1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/31404726-de1a-4aed-82d7-ce10d1dcf15e/final_image/HCFC1_fold_final_1.svg
