Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 16% [=========                                         ] |                     
 21% [===========                                       ] /                     
 27% [==============                                    ] -                     
 32% [=================                                 ] \                     
 38% [====================                              ] |                     
 43% [======================                            ] /                     
 48% [=========================                         ] -                     
 54% [============================                      ] \                     
 59% [==============================                    ] |                     
 65% [=================================                 ] /                     
 70% [====================================              ] -                     
 76% [=======================================           ] \                     
 81% [=========================================         ] |                     
 86% [============================================      ] /                     
 92% [===============================================   ] -                     
 97% [================================================= ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/328298af-6290-454b-bbbf-3de14fa0b770/final_image/DNAJC13_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.59 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.59 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.59 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 173.25 MB
Based on canonical annotations, the following gene is in your area of interest: DNAJC13(+)
write fasta - Elapsed time since the previous call: 1.16 seconds
write fasta - Current memory usage: 173.25 MB
Length of region: 92 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.92 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/328298af-6290-454b-bbbf-3de14fa0b770/fasta/DNAJC13.fasta" "/disk1/www/rails/humanrnamap/public/result/328298af-6290-454b-bbbf-3de14fa0b770/ct/DNAJC13.ct" --SHAPE "DNAJC13.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 176.92 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/328298af-6290-454b-bbbf-3de14fa0b770/ct/DNAJC13.ct" "/disk1/www/rails/humanrnamap/public/result/328298af-6290-454b-bbbf-3de14fa0b770/fold_FE/DNAJC13.txt" -sh "DNAJC13.dat"

efn2 - Elapsed time since the previous call: 0.52 seconds
efn2 - Current memory usage: 176.92 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/328298af-6290-454b-bbbf-3de14fa0b770/ct/DNAJC13.ct" 1 "/disk1/www/rails/humanrnamap/public/result/328298af-6290-454b-bbbf-3de14fa0b770/fold_dbn/DNAJC13_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.92 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAGAAGCAACAACGGAAUAAUCCAUGCAGCAGUUGAUAUGCUUUGUGCCCUUAUGUGUCCCAUGCAUGAUGACUAUGACUUAAGACAAGAAC', '-structureDBN', '..((((((.((((..................))))...))))))...........((((.....((((.....))))......)))).....', '-o', '/disk1/www/rails/humanrnamap/public/result/328298af-6290-454b-bbbf-3de14fa0b770/final_image/DNAJC13_fold_1.svg', '-title', 'DNAJC13, -11.1 ± 0.9\n kcal/mol, AUC: 0.733', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,6,14,15,18,21,25,26,29,32,33,34,35,37,39,40,42,43,44,45,46,47,51,52,54,55,56,57,58,63,64,67,68,70,71,74,76,77,80,81,84,89', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '4,5,7,9,10,59', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '66,69,8,73,13,16,20,85,24,90,27,41,48,49,60,61', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,65,72,11,12,75,78,79,17,82,19,83,22,23,86,87,88,91,28,92,30,31,36,38,50,53,62']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.92782140755959, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 125.42782140755958, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.92782140755958, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.92782140755958, Y: 285.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.92782140755958, Y: 265.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.92782140755958, Y: 245.62185299726755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.92782140755958, Y: 225.62185299726755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.92782140755958, Y: 205.62185299726755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 132.54813577440632, Y: 191.53240672839436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 132.54814272166635, Y: 174.03239615678316, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 120.68565841359843, Y: 157.93017686747888, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 108.82317410553053, Y: 141.82795757817465, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 96.96068979746259, Y: 125.72573828887042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 79.81745183658559, Y: 129.24137190379255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 62.40265287003935, Y: 127.51653438900925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 46.28213251666814, Y: 120.70631331813556, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 32.905356227907205, Y: 109.42304501422345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 23.475087603014583, Y: 94.68125675227938, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 18.839242730919533, Y: 77.8064462401731, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 19.414650400830975, Y: 60.31590040789456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 25.1495732296034, Y: 43.782269601394546, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 35.52835959280192, Y: 29.69216381312208, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 49.617808084298545, Y: 19.312485171512208, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 66.15107567604356, Y: 13.576515311290109, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 83.64158503379157, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 100.51668909117451, Y: 17.63477621359698, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 115.25907452428127, Y: 27.064111250562632, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 126.54318993100961, Y: 40.4401729648813, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 133.3544318696886, Y: 56.56026200776205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 135.08037222664274, Y: 73.97495170875482, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 131.565824266965, Y: 91.11841227355185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 123.12679614258201, Y: 106.44920128826007, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 134.98928045064994, Y: 122.5514205775643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 146.85176475871785, Y: 138.65363986686853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 158.71424906678578, Y: 154.75585915617276, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 175.42783047449768, Y: 159.94297748215948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 185.80750704071284, Y: 174.03241730000767, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 185.80750356708492, Y: 191.53241730000732, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 175.42782140755958, Y: 205.62185299726755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 175.42782140755958, Y: 225.62185299726755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 175.42782140755958, Y: 245.62185299726755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 175.42782140755958, Y: 265.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 175.42782140755958, Y: 285.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 175.42782140755958, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 192.92782140755958, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 210.42782140755958, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.92782140755958, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 245.42782140755958, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.9278214075596, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 280.4278214075596, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 297.9278214075596, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 315.4278214075596, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.9278214075596, Y: 305.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 350.4278214075596, Y: 305.6218529972676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 367.9278214075596, Y: 305.6218529972676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 385.4278214075596, Y: 305.6218529972676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 385.4278214075596, Y: 285.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 385.4278214075596, Y: 265.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 385.4278214075596, Y: 245.62185299726755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 370.42238543777745, Y: 236.6171731226443, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 359.75310982009853, Y: 222.7458384326558, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 354.900175152988, Y: 205.9322607823033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 356.5368436144304, Y: 188.5090382148505, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 364.43605528118843, Y: 172.89334664094227, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 377.5019288327974, Y: 161.25159777657305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 373.7771289192547, Y: 141.6015121379792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 370.05232900571207, Y: 121.95142649938535, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 366.3275290921694, Y: 102.3013408607915, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 356.78081343301204, Y: 87.6346770287926, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 360.38050282113056, Y: 70.50887648847527, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 375.02408659799306, Y: 60.92679623376671, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 392.158523750789, Y: 64.48514856238057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 401.7759128031839, Y: 79.10556701236152, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 398.25891825488446, Y: 96.24854100128462, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 401.9837181684271, Y: 115.89862663987847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 405.70851808196977, Y: 135.54871227847232, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 409.4333179955124, Y: 155.19879791706623, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 425.85332025106896, Y: 161.2513615001703, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 438.9193542395643, Y: 172.89304332933412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 446.81871430981727, Y: 188.5087440974871, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 448.45548913535555, Y: 205.93203219619235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 443.60260208538386, Y: 222.74570185157145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 432.93331451738624, Y: 236.61712221112268, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 417.9278214075596, Y: 245.62185299726755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 417.9278214075596, Y: 265.6218529972675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 417.9278214075596, Y: 285.6218529972676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 417.9278214075596, Y: 305.6218529972676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 435.4278214075596, Y: 305.6218529972676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 452.9278214075596, Y: 305.6218529972676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 470.4278214075596, Y: 305.6218529972676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 487.9278214075596, Y: 305.6218529972676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 505.4278214075596, Y: 305.6218529972676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 108.67782140755959, Y: 325.6218529972675, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 111.02328040767117, Y: 183.20050772452237, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: -4.0, Y: 56.66877488042803, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 151.30363860986523, Y: 75.00869731809723, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 191.67782140755958, Y: 225.62185299726755, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 276.6778214075596, Y: 325.6218529972675, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 353.36755755754234, Y: 251.54974005125098, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 340.11556169218807, Y: 59.228064482792206, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 462.28430967074326, Y: 182.96249356896251, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 466.6778214075596, Y: 325.6218529972676, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '92', X: 501.6778214075596, Y: 325.6218529972676, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'DNAJC13, -11.1 ± 0.9
 kcal/mol, AUC: 0.733', X: 193.88353206923955, Y: 338.4218529972676, Width: 147.0, Height: 23
Calculated bounding box: (-4.0, 5.0, 519.6778214075596, 338.4218529972676)
Updated viewBox: -9.0 0.0 533.6778214075596 343.4218529972676
Updated SVG: /disk1/www/rails/humanrnamap/public/result/328298af-6290-454b-bbbf-3de14fa0b770/final_image/DNAJC13_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/328298af-6290-454b-bbbf-3de14fa0b770/final_image/DNAJC13_fold_final_1.svg
