Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 20% [===========                                       ] /                     
 26% [==============                                    ] -                     
 31% [================                                  ] \                     
 36% [===================                               ] |                     
 41% [=====================                             ] /                     
 46% [========================                          ] -                     
 52% [===========================                       ] \                     
 57% [=============================                     ] |                     
 62% [================================                  ] /                     
 67% [==================================                ] -                     
 72% [=====================================             ] \                     
 78% [========================================          ] |                     
 83% [==========================================        ] /                     
 88% [=============================================     ] -                     
 93% [===============================================   ] \                     
 98% [==================================================] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/38eae2c5-f0d0-4e5e-9dcc-3c028b66dc44/final_image/DNAJC13_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.12 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.12 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.12 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.82 MB
Based on canonical annotations, the following gene is in your area of interest: DNAJC13(+)
write fasta - Elapsed time since the previous call: 1.21 seconds
write fasta - Current memory usage: 172.82 MB
Length of region: 96 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.09 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/38eae2c5-f0d0-4e5e-9dcc-3c028b66dc44/fasta/DNAJC13.fasta" "/disk1/www/rails/humanrnamap/public/result/38eae2c5-f0d0-4e5e-9dcc-3c028b66dc44/ct/DNAJC13.ct" --SHAPE "DNAJC13.dat"

fold - Elapsed time since the previous call: 0.13 seconds
fold - Current memory usage: 176.09 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/38eae2c5-f0d0-4e5e-9dcc-3c028b66dc44/ct/DNAJC13.ct" "/disk1/www/rails/humanrnamap/public/result/38eae2c5-f0d0-4e5e-9dcc-3c028b66dc44/fold_FE/DNAJC13.txt" -sh "DNAJC13.dat"

efn2 - Elapsed time since the previous call: 0.52 seconds
efn2 - Current memory usage: 176.09 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/38eae2c5-f0d0-4e5e-9dcc-3c028b66dc44/ct/DNAJC13.ct" 1 "/disk1/www/rails/humanrnamap/public/result/38eae2c5-f0d0-4e5e-9dcc-3c028b66dc44/fold_dbn/DNAJC13_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.09 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AACGUGAUCCGGCAACCUAUAAUAUUGCAACAUUGAAGCCUUUAGGAGAAGUAUUUGCGUUGGUCUGUGACUCAGAAAAUCCACAACUUUUUACCA', '-structureDBN', '..(((((((((((........................)))....))).......))))).(((((((.....))))....))).............', '-o', '/disk1/www/rails/humanrnamap/public/result/38eae2c5-f0d0-4e5e-9dcc-3c028b66dc44/final_image/DNAJC13_fold_1.svg', '-title', 'DNAJC13, -13.2 ± 2.9\n kcal/mol, AUC: 0.719', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,5,6,8,11,12,18,20,23,25,26,27,33,34,35,38,41,42,43,45,46,48,51,52,54,55,56,57,59,60,61,62,63,64,66,67,68,69,72,75,80,88,89,90,91,92', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,7,10,76,77,14,47,79,82,53,58', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '65,2,9,73,74,13,78,15,19,83,21,22,84,85,29,30,95,96,36,39,40,49,50', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '3,70,71,16,17,81,86,87,24,28,93,94,31,32,37,44']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 176.61515337318406, Y: 173.5058309183749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.11515337318406, Y: 173.5058309183749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 211.61515337318406, Y: 173.5058309183749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 211.61515337318406, Y: 153.5058309183749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 211.61515337318406, Y: 133.5058309183749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 211.61515337318406, Y: 113.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 211.61515337318406, Y: 93.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 195.68342490770533, Y: 77.5741024528962, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 175.68342490770533, Y: 77.5741024528962, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 155.68342490770533, Y: 77.5741024528962, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 141.59396806721782, Y: 87.95379155967314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 135.66582904605679, Y: 107.05502627750715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 129.73769002489576, Y: 126.15626099534117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.8135062473674, Y: 136.5544180028176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 155.0966086556457, Y: 149.93133362358876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.9727455766635, Y: 165.55876907161758, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 167.01314041104405, Y: 182.58596734565077, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 166.99783421513285, Y: 200.08596840854483, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.92766025766275, Y: 217.1060728570158, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 155.02419865663546, Y: 232.71970684151836, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.71771356598532, Y: 246.07686471195743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 129.62372961113311, Y: 256.45038329348495, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 113.5095227514018, Y: 263.27552862253947, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 96.25234980549023, Y: 266.1807400426989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 78.79169062307678, Y: 265.0078579529179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 62.07810283694381, Y: 259.82073401029294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 47.02147354100386, Y: 250.90175504823847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 34.44148507094128, Y: 238.73646994783823, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 25.022991528517323, Y: 223.98715637492086, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 19.27873534988693, Y: 207.45676640870425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 17.521433626553247, Y: 190.0452138606373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 19.846753798603586, Y: 172.70038300016526, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 26.128105522849083, Y: 156.3665257705564, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 36.023532246372966, Y: 141.93285674842983, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 48.994327308480834, Y: 130.185144335465, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 64.33436111115829, Y: 121.76293355600572, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 81.20852278797487, Y: 117.12472924985664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 98.69818360841545, Y: 116.52303508595446, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 104.62632262957653, Y: 97.42180036812044, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 110.55446165073757, Y: 78.32056565028643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 104.81743106661061, Y: 61.78767479366999, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 110.00454939259733, Y: 45.074093385958065, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.09398921044544, Y: 34.69441681974291, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 141.5939892104451, Y: 34.6944202933708, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 155.68342490770533, Y: 45.07410245289617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 175.68342490770533, Y: 45.07410245289617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 195.6834249077054, Y: 45.07410245289617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 206.59487204265037, Y: 32.21566245440516, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 222.16056892847695, Y: 25.72657636836317, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 238.97451262016716, Y: 27.02675147432535, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 253.35756545036696, Y: 35.831690375713265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 262.1625043517549, Y: 50.214743205913095, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.46267945771706, Y: 67.02868689760331, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 256.9735933716751, Y: 82.59438378342989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.11515337318406, Y: 93.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.11515337318406, Y: 113.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.11515337318406, Y: 133.5058309183749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 244.11515337318406, Y: 153.5058309183749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.11515337318406, Y: 173.5058309183749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 261.61515337318406, Y: 173.5058309183749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.11515337318406, Y: 173.5058309183749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 279.11515337318406, Y: 153.5058309183749, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 279.11515337318406, Y: 133.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 268.7354642664071, Y: 119.41637407788741, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 249.6342295485731, Y: 113.48823505672635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 230.53299483073909, Y: 107.5600960355653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 211.43176011290507, Y: 101.63195701440426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.00061856095124, Y: 103.18312174885858, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 180.56456256607572, Y: 91.97048570106693, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.97133894529526, Y: 74.54313804481549, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 190.151519557163, Y: 61.08006375534936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 207.57497183569973, Y: 59.444790525818604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 221.06498602229175, Y: 70.59245059792394, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 240.16622074012577, Y: 76.52058961908503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 259.2674554579598, Y: 82.44872864024606, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 278.3686901757938, Y: 88.37686766140715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 294.90158103241026, Y: 82.63983707728013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 311.61516244012216, Y: 87.82695540326685, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 321.99483900633726, Y: 101.91639522111498, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 321.9948355327094, Y: 119.41639522111467, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 311.61515337318406, Y: 133.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 311.61515337318406, Y: 153.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 311.61515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 329.11515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 346.61515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 364.11515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 381.61515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 399.11515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 416.61515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 434.11515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 451.61515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.11515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 486.61515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 504.11515337318406, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 521.6151533731841, Y: 173.50583091837493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 539.1151533731841, Y: 173.50583091837495, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 177.36515337318406, Y: 193.5058309183749, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 151.93342490770533, Y: 97.5741024528962, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 167.94274751101324, Y: 243.77228478013623, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: -4.0, Y: 211.77284050840143, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 87.00631448498001, Y: 75.48624583717324, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 241.3875255468335, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 257.86515337318406, Y: 193.5058309183749, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 156.12010422746124, Y: 68.61499902365443, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 337.2454170687618, Y: 125.65962365613314, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 430.36515337318406, Y: 193.50583091837493, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '96', X: 535.3651533731841, Y: 193.50583091837495, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'DNAJC13, -13.2 ± 2.9
 kcal/mol, AUC: 0.719', X: 210.06829349986862, Y: 283.9807400426989, Width: 147.0, Height: 23
Calculated bounding box: (-4.0, 0.0, 553.3651533731841, 283.9807400426989)
Updated viewBox: -9.0 -5.0 567.3651533731841 293.9807400426989
Updated SVG: /disk1/www/rails/humanrnamap/public/result/38eae2c5-f0d0-4e5e-9dcc-3c028b66dc44/final_image/DNAJC13_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/38eae2c5-f0d0-4e5e-9dcc-3c028b66dc44/final_image/DNAJC13_fold_final_1.svg
