Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 36% [===================                               ] \                     
 42% [======================                            ] |                     
 48% [=========================                         ] /                     
 54% [============================                      ] -                     
 60% [===============================                   ] \                     
 67% [==================================                ] |                     
 73% [=====================================             ] /                     
 79% [========================================          ] -                     
 85% [===========================================       ] \                     
 91% [==============================================    ] |                     
 97% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/final_image/KRAS_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.82 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.82 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.82 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.43 MB
Based on canonical annotations, the following gene is in your area of interest: KRAS(-)
write fasta - Elapsed time since the previous call: 0.56 seconds
write fasta - Current memory usage: 170.43 MB
Length of region: 82 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.21 seconds
write dat - Current memory usage: 173.84 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/fasta/KRAS.fasta" "/disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/ct/KRAS.ct" --SHAPE "KRAS.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 173.84 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/ct/KRAS.ct" "/disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/fold_FE/KRAS.txt" -sh "KRAS.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 173.84 MB
This region has 2 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/ct/KRAS.ct" 1 "/disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/fold_dbn/KRAS_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 173.84 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/ct/KRAS.ct" 2 "/disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/fold_dbn/KRAS_temp2.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.84 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AACACUGGUUAAAUUAACAUUGCAUAAACACUUUUCAAGUCUGAUCCAUAUUUAAUAAUGCUUUAAAAUAAAAAUAAAAACA', '-structureDBN', '..................................................................................', '-o', '/disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/final_image/KRAS_fold_1.svg', '-title', 'KRAS, 0.0 ± 0.0\n kcal/mol, AUC: 0.67', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '6,7,8,9,10,14,15,20,21,22,25,32,33,34,35,39,40,42,43,45,49,51,52,53,56,59,60,62,63,64,69,75', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,37,70,71,72,11,76,78,82,55', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '65,2,66,4,77,47,16,48,50,81,57,28,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '3,67,5,68,73,74,12,13,79,80,17,18,19,23,24,26,27,29,30,36,38,41,44,46,54,58,61']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 13.000000000000007, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 109.75, Y: 13.000000000000007, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 13.000000000000007, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 13.000000000000007, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 13.000000000000014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 13.000000000000014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 13.000000000000014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 13.000000000000014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.25, Y: 13.000000000000014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 13.000000000000014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.25, Y: 13.000000000000014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.75, Y: 13.000000000000014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 302.25, Y: 13.000000000000014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 13.000000000000014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 337.25, Y: 13.000000000000021, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 354.75, Y: 13.000000000000021, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 372.25, Y: 13.000000000000021, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 389.75, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 407.25, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 424.75, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 442.25, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 459.75, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 477.25, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 494.75, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 512.25, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 529.75, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 547.25, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 564.75, Y: 13.000000000000036, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 582.25, Y: 13.000000000000036, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 599.75, Y: 13.000000000000036, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 617.25, Y: 13.000000000000043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 634.75, Y: 13.000000000000043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 652.25, Y: 13.000000000000043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 669.75, Y: 13.000000000000043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 687.25, Y: 13.000000000000043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 704.75, Y: 13.000000000000043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 722.25, Y: 13.000000000000043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 739.75, Y: 13.000000000000043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 757.25, Y: 13.000000000000043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 774.75, Y: 13.000000000000043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 792.25, Y: 13.00000000000005, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 809.75, Y: 13.00000000000005, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 827.25, Y: 13.00000000000005, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 844.75, Y: 13.00000000000005, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 862.25, Y: 13.000000000000057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 879.75, Y: 13.000000000000057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 897.25, Y: 13.000000000000057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 914.75, Y: 13.000000000000057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 932.25, Y: 13.000000000000057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 949.75, Y: 13.000000000000057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 967.25, Y: 13.000000000000057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 984.75, Y: 13.000000000000057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1002.25, Y: 13.000000000000057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1019.75, Y: 13.000000000000057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 1037.25, Y: 13.000000000000064, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1054.75, Y: 13.000000000000064, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1072.25, Y: 13.000000000000064, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1089.75, Y: 13.000000000000071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1107.25, Y: 13.000000000000071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1124.75, Y: 13.000000000000071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1142.25, Y: 13.000000000000071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1159.75, Y: 13.000000000000071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1177.25, Y: 13.000000000000071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1194.75, Y: 13.000000000000071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1212.25, Y: 13.000000000000071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1229.75, Y: 13.000000000000071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1247.25, Y: 13.000000000000071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1264.75, Y: 13.000000000000078, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1282.25, Y: 13.000000000000078, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1299.75, Y: 13.000000000000078, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1317.25, Y: 13.000000000000085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1334.75, Y: 13.000000000000085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1352.25, Y: 13.000000000000085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1369.75, Y: 13.000000000000085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1387.25, Y: 13.000000000000085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1404.75, Y: 13.000000000000085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1422.25, Y: 13.000000000000085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 33.0, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 33.000000000000014, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 33.00000000000002, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 508.5, Y: 33.00000000000003, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 683.5, Y: 33.00000000000004, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 858.5, Y: 33.00000000000006, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 1033.5, Y: 33.000000000000064, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 1208.5, Y: 33.00000000000007, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 1383.5, Y: 33.000000000000085, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '82', X: 1418.5, Y: 33.000000000000085, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'KRAS, 0.0 ± 0.0
 kcal/mol, AUC: 0.67', X: 652.0, Y: 45.80000000000008, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 5.0, 1436.5, 45.80000000000008)
Updated viewBox: -0.25 0.0 1441.75 50.80000000000008
Updated SVG: /disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/final_image/KRAS_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/393e6c96-76c9-4b73-b4c4-f0c4179c0597/final_image/KRAS_fold_final_1.svg
Traceback (most recent call last):
  File "/disk1/www/rails/humanrnamap/cli/./main.py", line 665, in <module>
    main()
  File "/disk1/www/rails/humanrnamap/cli/./main.py", line 512, in main
    AUC = AUC_list[x-1]
          ~~~~~~~~^^^^^
IndexError: list index out of range
