Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  4% [===                                               ] -                     
  9% [=====                                             ] \                     
 14% [========                                          ] |                     
 18% [==========                                        ] /                     
 23% [============                                      ] -                     
 28% [===============                                   ] \                     
 33% [=================                                 ] |                     
 37% [===================                               ] /                     
 42% [======================                            ] -                     
 47% [========================                          ] \                     
 51% [==========================                        ] |                     
 56% [=============================                     ] /                     
 61% [===============================                   ] -                     
 66% [==================================                ] \                     
 70% [====================================              ] |                     
 75% [======================================            ] /                     
 80% [=========================================         ] -                     
 84% [===========================================       ] \                     
 89% [=============================================     ] |                     
 94% [================================================  ] /                     
 99% [==================================================] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/3b425fd7-622c-433c-8690-165620816525/final_image/NORAD_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.36 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.36 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.36 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.89 MB
Based on canonical annotations, the following gene is in your area of interest: NORAD(-)
write fasta - Elapsed time since the previous call: 0.28 seconds
write fasta - Current memory usage: 170.89 MB
Length of region: 106 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.21 seconds
write dat - Current memory usage: 174.21 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/3b425fd7-622c-433c-8690-165620816525/fasta/NORAD.fasta" "/disk1/www/rails/humanrnamap/public/result/3b425fd7-622c-433c-8690-165620816525/ct/NORAD.ct" --SHAPE "NORAD.dat"

fold - Elapsed time since the previous call: 0.15 seconds
fold - Current memory usage: 174.21 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/3b425fd7-622c-433c-8690-165620816525/ct/NORAD.ct" "/disk1/www/rails/humanrnamap/public/result/3b425fd7-622c-433c-8690-165620816525/fold_FE/NORAD.txt" -sh "NORAD.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 174.21 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/3b425fd7-622c-433c-8690-165620816525/ct/NORAD.ct" 1 "/disk1/www/rails/humanrnamap/public/result/3b425fd7-622c-433c-8690-165620816525/fold_dbn/NORAD_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 174.21 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGUUAGAAAGUUACACAUCUUGUAAAUUCUCAUUUGUUUAAAAGAAAUCAUAGAAAAUACAUGUCUUCUGGAGAUGACUUUUGGAAAUGGAGUUGUUAAGACGGCC', '-structureDBN', '.................((((.(((((........))))).)))).................(((.(((...(((((((((.......))))))))).))).))).', '-o', '/disk1/www/rails/humanrnamap/public/result/3b425fd7-622c-433c-8690-165620816525/final_image/NORAD_fold_1.svg', '-title', 'NORAD, -12.2 ± 1.0\n kcal/mol, AUC: 0.683', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,6,10,11,12,18,20,21,22,23,27,28,30,33,34,35,36,37,38,39,44,48,51,53,58,62,63,64,66,67,69,70,71,73,75,76,79,80,81,82,83,84,88,89,90,92,93,94,95,96,97,100,103,104', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '65,68,72,24,106,77', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '5,40,105,13,45,78,17,85,55,25,91,57', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,7,8,9,14,15,16,19,26,29,31,32,41,42,43,46,47,49,50,52,54,56,59,60,61,74,86,87,98,99,101,102']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.25, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 342.09226195641565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 302.25, Y: 322.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 302.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 282.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 295.57162284851074, Y: 265.9167255263329, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 249.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 229.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 209.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 189.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 169.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 290.5949319257163, Y: 156.68707490807003, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 287.9117893094517, Y: 139.39397643628024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 295.06324539329535, Y: 123.42190127570427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 309.7499927277997, Y: 113.90612690959705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 327.2500072722003, Y: 113.90612690959699, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 341.93675460670465, Y: 123.42190127570427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.0882106905483, Y: 139.39397643628024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 346.4050680742837, Y: 156.68707490807003, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.75, Y: 169.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 189.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 209.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 229.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 249.74118909625014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 341.42837715148926, Y: 265.9167255263329, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 282.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 302.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.75, Y: 322.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 404.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 422.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 439.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 474.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 492.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 509.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 527.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 544.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 562.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 579.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 597.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 614.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 632.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 649.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 649.75, Y: 322.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 649.75, Y: 302.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 643.0716228485107, Y: 285.9167255263329, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 649.75, Y: 269.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 649.75, Y: 249.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 649.75, Y: 229.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 639.3703161036602, Y: 215.65174811318366, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 639.3703178404746, Y: 198.15174282737735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 649.75000453347, Y: 184.06230390460587, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 666.4635945930745, Y: 178.87519562322774, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 678.3260916858515, Y: 162.77298575241002, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 690.1885887786284, Y: 146.67077588159236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 702.0510858714053, Y: 130.5685660107747, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 713.9135829641823, Y: 114.46635613995699, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 725.7760800569592, Y: 98.36414626913927, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 737.6385771497362, Y: 82.26193639832161, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 749.5010742425131, Y: 66.15972652750395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 761.3635713352901, Y: 50.057516656686175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 761.2734893440678, Y: 32.55774301062593, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 771.5344247804704, Y: 18.381587100138063, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 788.1864130314907, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 804.8030142643312, Y: 18.4898775849058, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 814.9714454263801, Y: 32.732531836524686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 814.7674417348514, Y: 50.2313482228501, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 804.2697335749407, Y: 64.23307368144378, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 787.5296623753688, Y: 69.33407443244869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 775.6671652825919, Y: 85.43628430326646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 763.804668189815, Y: 101.53849417408412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 751.942171097038, Y: 117.64070404490178, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 740.079674004261, Y: 133.7429139157195, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 728.2171769114841, Y: 149.84512378653721, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 716.3546798187072, Y: 165.94733365735487, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 704.4921827259302, Y: 182.04954352817253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 692.6296856331533, Y: 198.15175339899025, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 692.6296821595254, Y: 215.6517533989899, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 682.25, Y: 229.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 682.25, Y: 249.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 682.25, Y: 269.7411890962502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 688.9283771514893, Y: 285.9167255263329, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 682.25, Y: 302.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 682.25, Y: 322.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 682.25, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 699.75, Y: 342.0922619564157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 362.09226195641565, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 362.09226195641565, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 278.5, Y: 302.0922619564157, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 276.1256036554374, Y: 110.40900235031205, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 351.0, Y: 249.74118909625014, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 418.5, Y: 362.0922619564157, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 593.5, Y: 362.0922619564157, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 616.6197333283709, Y: 221.89497277671913, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 729.6488643716955, Y: 54.297229434727, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 788.0193751534096, Y: 97.29878139604341, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '100', X: 694.0, Y: 249.7411890962502, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '106', X: 691.5, Y: 362.0922619564157, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'NORAD, -12.2 ± 1.0
 kcal/mol, AUC: 0.683', X: 343.86072271319006, Y: 374.8922619564157, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 825.4714454263801, 374.8922619564157)
Updated viewBox: -0.25 0.0 830.7214454263801 379.8922619564157
Updated SVG: /disk1/www/rails/humanrnamap/public/result/3b425fd7-622c-433c-8690-165620816525/final_image/NORAD_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/3b425fd7-622c-433c-8690-165620816525/final_image/NORAD_fold_final_1.svg
