Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  4% [===                                               ] -                     
  9% [=====                                             ] \                     
 14% [========                                          ] |                     
 19% [==========                                        ] /                     
 24% [=============                                     ] -                     
 28% [===============                                   ] \                     
 33% [=================                                 ] |                     
 38% [====================                              ] /                     
 43% [======================                            ] -                     
 48% [=========================                         ] \                     
 52% [===========================                       ] |                     
 57% [=============================                     ] /                     
 62% [================================                  ] -                     
 67% [==================================                ] \                     
 72% [=====================================             ] |                     
 76% [=======================================           ] /                     
 81% [=========================================         ] -                     
 86% [============================================      ] \                     
 91% [==============================================    ] |                     
 96% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/3c7bf90e-b859-4927-a189-67393e9168eb/final_image/NORAD_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.09 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.09 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.09 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.61 MB
Based on canonical annotations, the following gene is in your area of interest: NORAD(-)
write fasta - Elapsed time since the previous call: 0.30 seconds
write fasta - Current memory usage: 170.61 MB
Length of region: 104 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 174.19 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/3c7bf90e-b859-4927-a189-67393e9168eb/fasta/NORAD.fasta" "/disk1/www/rails/humanrnamap/public/result/3c7bf90e-b859-4927-a189-67393e9168eb/ct/NORAD.ct" --SHAPE "NORAD.dat"

fold - Elapsed time since the previous call: 0.14 seconds
fold - Current memory usage: 174.19 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/3c7bf90e-b859-4927-a189-67393e9168eb/ct/NORAD.ct" "/disk1/www/rails/humanrnamap/public/result/3c7bf90e-b859-4927-a189-67393e9168eb/fold_FE/NORAD.txt" -sh "NORAD.dat"

efn2 - Elapsed time since the previous call: 0.40 seconds
efn2 - Current memory usage: 174.19 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/3c7bf90e-b859-4927-a189-67393e9168eb/ct/NORAD.ct" 1 "/disk1/www/rails/humanrnamap/public/result/3c7bf90e-b859-4927-a189-67393e9168eb/fold_dbn/NORAD_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 174.19 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGAAGUAGAGUUAGUAAACUAACACAUUUUGUACACUUUGUUAAAAUUUGUAGAAAGGCUGUCUUCUGAAAAGGACUUUUGGAAGUGAGAUAACAUCAGCUCUA', '-structureDBN', '.....((((((((((...((.(((.((((((.((.....)))))))).)))))....)))).(((((((((.....)))))))))...(((...))).))))))', '-o', '/disk1/www/rails/humanrnamap/public/result/3c7bf90e-b859-4927-a189-67393e9168eb/final_image/NORAD_fold_1.svg', '-title', 'NORAD, -17.1 ± 1.0\n kcal/mol, AUC: 0.603', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,5,6,8,10,11,12,14,15,20,27,28,29,30,31,32,37,38,39,40,41,42,47,48,49,50,51,53,57,58,60,61,62,64,65,67,68,73,74,77,78,79,80,81,82,85,86,87,89,91,96,99,101,103', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '66,69,70,7,9,75,76,13,16,17,18,19,23,24,25,26,94,33,97,43,44,63', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '35,4,100,21,22,95', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,3,71,72,83,84,88,90,92,93,34,98,36,102,104,45,46,52,54,55,56,59']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 265.05139725293276, Y: 334.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 282.55139725293276, Y: 334.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 300.05139725293276, Y: 334.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.55139725293276, Y: 334.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 335.05139725293276, Y: 334.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 352.55139725293276, Y: 334.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.55139725293276, Y: 314.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.55139725293276, Y: 294.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.55139725293276, Y: 274.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.55139725293276, Y: 254.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 352.55139725293276, Y: 234.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.59218068439793, Y: 233.33279439025017, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 335.450045060667, Y: 247.47493001398112, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 321.30790943693603, Y: 261.6170656377121, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 307.1657738132051, Y: 275.7592012614431, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 308.4359692350239, Y: 293.2131189099518, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 301.33743854941014, Y: 309.2088527098103, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 287.54279852349674, Y: 319.97735048090175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 270.3024607178995, Y: 322.9812462912505, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 260.0154996794686, Y: 340.1328769015978, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 254.50313728317792, Y: 356.74209514446767, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 238.19460628328648, Y: 363.0890697350029, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 221.58631917092197, Y: 374.2319957059168, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 204.97803205855752, Y: 385.3749216768307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 195.26650087229115, Y: 399.9328597992917, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.1133156140275, Y: 403.3992175210093, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 161.5050675544215, Y: 414.5422016989839, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.89681949481542, Y: 425.6851858769585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 128.28857143520935, Y: 436.828170054933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.68032337560334, Y: 447.97115423290757, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 95.07207531599721, Y: 459.11413841088216, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 83.01530462642387, Y: 471.7982446216629, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 65.55622717312343, Y: 470.60121316552863, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 45.78484375885586, Y: 473.6165734899387, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 30.7841775271674, Y: 482.6293877254118, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 13.798986372743627, Y: 478.4158275578869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 4.75, Y: 463.4369539866345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 8.922560627740097, Y: 446.44164446766723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 23.879554314369443, Y: 437.35653865123356, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 40.88488323168957, Y: 441.48807544175384, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 60.656266645957146, Y: 438.47271511734385, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 76.96472602678858, Y: 432.12573531402234, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 93.5729740863946, Y: 420.98275113604774, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 110.18122214600072, Y: 409.8397669580732, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 126.78947020560673, Y: 398.6967827800986, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.3977182652128, Y: 387.55379860212406, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 160.00596632481887, Y: 376.41081442414946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 169.71751321935614, Y: 361.85279749480077, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 186.87077735582244, Y: 358.3864551192384, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 203.4790644681869, Y: 347.2435291483245, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 220.0873515805514, Y: 336.1006031774106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.14409993765418, Y: 323.4165652141475, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 242.43106097608512, Y: 306.26493460380016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 236.96273584020986, Y: 289.6412340468136, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 239.96674873879653, Y: 272.40099314057557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 250.73527444858757, Y: 258.6064705305839, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 266.73096230831476, Y: 251.50802211602354, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 284.18480342464227, Y: 252.77823087288027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 298.3269390483732, Y: 238.63609524914932, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 312.46907467210417, Y: 224.49395962541837, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 326.6112102958351, Y: 210.35182400168742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 322.4440259226715, Y: 191.14260743315253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 326.6112102958351, Y: 171.93339086461765, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 312.46907467210417, Y: 157.79125524088676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 298.3269390483732, Y: 143.6491196171558, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.18480342464227, Y: 129.50698399342485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 270.0426678009113, Y: 115.3648483696939, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 255.90053217718037, Y: 101.22271274596295, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 241.75839655344942, Y: 87.080577122232, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.61626092971846, Y: 72.93844149850105, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 213.47412530598757, Y: 58.7963058747701, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.32648642593563, Y: 52.05059861480822, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 190.65878981978022, Y: 35.87059151326679, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.36551127995233, Y: 19.706721460172048, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 213.52938133304707, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.7093884345885, Y: 19.667696606155346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 236.45509569455032, Y: 35.81533548620729, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 250.59723131828127, Y: 49.95747110993824, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.7393669420122, Y: 64.09960673366919, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 278.8815025657432, Y: 78.24174235740014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 293.0236381894741, Y: 92.38387798113115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 307.1657738132051, Y: 106.5260136048621, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 321.30790943693603, Y: 120.66814922859305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 335.450045060667, Y: 134.810284852324, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 349.59218068439793, Y: 148.9524204760549, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 368.00051949343367, Y: 144.79215466873973, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 386.5415952290201, Y: 148.31398088009865, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 402.14242280835913, Y: 158.93419406701275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 412.2173318467167, Y: 174.89260743315253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 432.2173318467167, Y: 174.89260743315253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 452.2173318467167, Y: 174.89260743315253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 469.69207973363814, Y: 175.83280857170968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 478.16915769214324, Y: 191.14260743315253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 469.69207973363814, Y: 206.4524062945954, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 452.2173318467167, Y: 207.39260743315253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 432.2173318467167, Y: 207.39260743315253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 412.2173318467167, Y: 207.39260743315253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 401.58100887854334, Y: 223.92221905876306, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 385.05139725293276, Y: 234.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 385.05139725293276, Y: 254.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 385.05139725293276, Y: 274.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 385.05139725293276, Y: 294.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 385.05139725293276, Y: 314.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 385.05139725293276, Y: 334.5585420269365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 265.80139725293276, Y: 354.5585420269365, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 328.80139725293276, Y: 254.5585420269365, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 263.48005031046415, Y: 358.7863017665603, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 119.07330755357793, Y: 464.57940229251363, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 27.85935990912717, Y: 423.76902729879197, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 188.58613849727297, Y: 330.63524203596, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 294.5769390483732, Y: 210.35182400168742, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 209.7241253059875, Y: 87.080577122232, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 289.2736381894741, Y: 64.09960673366919, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 428.4673318467167, Y: 154.89260743315253, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '100', X: 396.80139725293276, Y: 254.5585420269365, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '104', X: 376.80139725293276, Y: 354.5585420269365, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'NORAD, -17.1 ± 1.0
 kcal/mol, AUC: 0.603', X: 175.45957884607162, Y: 500.4293877254118, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 488.66915769214324, 500.4293877254118)
Updated viewBox: -0.25 0.0 493.91915769214324 505.4293877254118
Updated SVG: /disk1/www/rails/humanrnamap/public/result/3c7bf90e-b859-4927-a189-67393e9168eb/final_image/NORAD_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/3c7bf90e-b859-4927-a189-67393e9168eb/final_image/NORAD_fold_final_1.svg
