Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/3d6a9f80-c4ed-48aa-acc1-6f85c37d88ab/final_image/DNAJC13_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.97 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.97 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.97 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.66 MB
Based on canonical annotations, the following gene is in your area of interest: DNAJC13(+)
write fasta - Elapsed time since the previous call: 1.14 seconds
write fasta - Current memory usage: 172.66 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 176.16 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/3d6a9f80-c4ed-48aa-acc1-6f85c37d88ab/fasta/DNAJC13.fasta" "/disk1/www/rails/humanrnamap/public/result/3d6a9f80-c4ed-48aa-acc1-6f85c37d88ab/ct/DNAJC13.ct" --SHAPE "DNAJC13.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.16 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/3d6a9f80-c4ed-48aa-acc1-6f85c37d88ab/ct/DNAJC13.ct" "/disk1/www/rails/humanrnamap/public/result/3d6a9f80-c4ed-48aa-acc1-6f85c37d88ab/fold_FE/DNAJC13.txt" -sh "DNAJC13.dat"

efn2 - Elapsed time since the previous call: 0.51 seconds
efn2 - Current memory usage: 176.16 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/3d6a9f80-c4ed-48aa-acc1-6f85c37d88ab/ct/DNAJC13.ct" 1 "/disk1/www/rails/humanrnamap/public/result/3d6a9f80-c4ed-48aa-acc1-6f85c37d88ab/fold_dbn/DNAJC13_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.16 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACAUUUCGUAAAGGCAGUGGAAAAAAGUCAGAAACUUUAAAAUUUUCUACAGAGCACAGAACAGAACUUCUUACAGAAGCAUUGA', '-structureDBN', '.............((.((((((((((((.....)))).....))))))))...))...........(((((...)))))......', '-o', '/disk1/www/rails/humanrnamap/public/result/3d6a9f80-c4ed-48aa-acc1-6f85c37d88ab/final_image/DNAJC13_fold_1.svg', '-title', 'DNAJC13, -11.8 ± 0.8\n kcal/mol, AUC: 0.758', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,5,6,8,9,13,14,17,18,19,20,27,28,31,36,37,38,43,44,45,46,48,52,54,59,64,68,69,71,72,76,79,82,83,84', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '21,70,39,40,22,77', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '67,73,12,78,23,24,25,26,30,33,41,47,49,51,55,56,58,61', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,3,65,66,7,10,11,74,75,15,16,80,81,85,29,32,34,35,42,50,53,57,60,62,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 252.42103311703585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 252.42103311703585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 252.42103311703585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 252.42103311703585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 252.42103311703585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 252.42103311703585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 252.42103311703585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 232.25, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 232.42103311703585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 221.87031436684674, Y: 218.33158684816266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 221.87032131410677, Y: 200.83157627655146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 210.00783700603887, Y: 184.72935698724723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 198.14535269797096, Y: 168.62713769794294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 186.28286838990306, Y: 152.5249184086387, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 174.42038408183515, Y: 136.4226991193344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.55789977376725, Y: 120.32047983003017, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 150.69541546569934, Y: 104.21826054072588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 138.83293115763144, Y: 88.11604125142165, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 121.72730885164697, Y: 84.42236510560346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 104.27755795437508, Y: 94.19509213664034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 86.82780705710317, Y: 103.96781916767716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 69.37805615983126, Y: 113.74054619871404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 58.50272996282877, Y: 127.45105632585583, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 41.12034991568589, Y: 129.47680846626068, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 27.383636261543018, Y: 118.63459901330552, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 25.315944283876547, Y: 101.25715795533725, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 36.12497385700169, Y: 87.4943207651003, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 53.497374734396374, Y: 85.38470099064719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 70.94712563166829, Y: 75.61197395961031, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 88.3968765289402, Y: 65.83924692857349, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 105.84662742621208, Y: 56.066519897536665, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.63441949432936, Y: 39.55133104072243, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 125.51101301712251, Y: 28.888772614004324, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.95968478323476, Y: 27.549424414888108, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 158.3010279091331, Y: 35.969233860086575, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 166.54155458555684, Y: 51.40761849369213, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 164.99903750275087, Y: 68.8395042508113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 176.86152181081877, Y: 84.94172354011553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 188.72400611888668, Y: 101.04394282941976, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 200.58649042695458, Y: 117.14616211872405, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.4489747350225, Y: 133.24838140802828, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 224.3114590430904, Y: 149.35060069733257, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 236.1739433511583, Y: 165.45281998663683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 248.0364276592262, Y: 181.5550392759411, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.7500090669381, Y: 186.74215760192783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 275.12968563315326, Y: 200.83159741977596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 275.1296821595253, Y: 218.33159741977562, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 264.75, Y: 232.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.75, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 252.42103311703588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 387.25, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 422.25, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.25, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 474.75, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 232.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 212.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 474.75, Y: 192.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 172.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 475.69020113855714, Y: 154.94628523011443, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 491.0, Y: 146.46920727160935, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 506.3097988614429, Y: 154.94628523011443, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 172.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 192.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 212.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 232.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 524.75, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 559.75, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 577.25, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 594.75, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 612.25, Y: 252.4210331170359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 272.42103311703585, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 272.4210331170359, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 166.4306491005988, Y: 164.38740271670662, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 31.918652920328583, Y: 148.71944341760795, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 143.43105956481665, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 258.3111357821602, Y: 167.29644319966098, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 348.5, Y: 272.4210331170359, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 451.0, Y: 192.4210331170359, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 521.0, Y: 272.4210331170359, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 608.5, Y: 272.4210331170359, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'DNAJC13, -11.8 ± 0.8
 kcal/mol, AUC: 0.758', X: 240.25, Y: 285.2210331170359, Width: 147.0, Height: 23
Calculated bounding box: (4.75, 0.0, 626.5, 285.2210331170359)
Updated viewBox: -0.25 -5.0 631.75 295.2210331170359
Updated SVG: /disk1/www/rails/humanrnamap/public/result/3d6a9f80-c4ed-48aa-acc1-6f85c37d88ab/final_image/DNAJC13_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/3d6a9f80-c4ed-48aa-acc1-6f85c37d88ab/final_image/DNAJC13_fold_final_1.svg
