Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 36% [===================                               ] \                     
 42% [======================                            ] |                     
 48% [=========================                         ] /                     
 54% [============================                      ] -                     
 60% [===============================                   ] \                     
 67% [==================================                ] |                     
 73% [=====================================             ] /                     
 79% [========================================          ] -                     
 85% [===========================================       ] \                     
 91% [==============================================    ] |                     
 97% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/41b179a0-8a84-4814-b15f-c4b0e17bd8a8/final_image/CLASP1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.71 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.71 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.71 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.25 MB
Based on canonical annotations, the following gene is in your area of interest: CLASP1(-)
write fasta - Elapsed time since the previous call: 1.57 seconds
write fasta - Current memory usage: 170.25 MB
Length of region: 82 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 173.53 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/41b179a0-8a84-4814-b15f-c4b0e17bd8a8/fasta/CLASP1.fasta" "/disk1/www/rails/humanrnamap/public/result/41b179a0-8a84-4814-b15f-c4b0e17bd8a8/ct/CLASP1.ct" --SHAPE "CLASP1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 173.53 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/41b179a0-8a84-4814-b15f-c4b0e17bd8a8/ct/CLASP1.ct" "/disk1/www/rails/humanrnamap/public/result/41b179a0-8a84-4814-b15f-c4b0e17bd8a8/fold_FE/CLASP1.txt" -sh "CLASP1.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 173.53 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/41b179a0-8a84-4814-b15f-c4b0e17bd8a8/ct/CLASP1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/41b179a0-8a84-4814-b15f-c4b0e17bd8a8/fold_dbn/CLASP1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 173.53 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAACACUCAAUGCCUCUGGAGCACAGACUUUAACACUAAGCAAGAUUGUGCCACAUAUAUGCAACUUACUUGGAGAUCCAAA', '-structureDBN', '..........(((...((..((((((.(((...........))).))))))..)).....)))......((((....)))).', '-o', '/disk1/www/rails/humanrnamap/public/result/41b179a0-8a84-4814-b15f-c4b0e17bd8a8/final_image/CLASP1_fold_1.svg', '-title', 'CLASP1, -11.3 ± 1.1\n kcal/mol, AUC: 0.588', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '7,11,12,15,17,18,19,21,26,29,30,31,37,40,44,46,47,48,49,50,56,58,60,61,66,67,70,71,72,73,75,77', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '16,80,20,25,13,14', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '68,5,9,10,76,22,23,24,33,34,35,36,38,41,43,51,53,62,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,2,3,4,65,6,69,8,74,78,79,81,82,27,28,32,39,42,45,52,54,55,57,59']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 384.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 364.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 165.92691721038744, Y: 353.78814254286806, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 158.2313747176388, Y: 338.0709935894436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 158.2313776065814, Y: 320.57098943282057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 165.92692528857876, Y: 304.8538430201942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 157.13202463684215, Y: 286.8913898880053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 141.61403238210667, Y: 278.80175682753935, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 133.91849433237303, Y: 263.08460247962654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 137.04496850453515, Y: 245.86614128468187, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 128.2500749836425, Y: 227.9036846610416, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 119.4551814627498, Y: 209.94122803740123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 110.66028794185712, Y: 191.97877141376097, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 101.86539442096445, Y: 174.0163147901206, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 93.07050090007178, Y: 156.05385816648032, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 79.95940954613127, Y: 144.46305647428255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 78.84426297470537, Y: 126.99869709629615, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 70.04930650077439, Y: 109.03627129626409, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 61.25435002684338, Y: 91.07384549623191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 44.10311403788819, Y: 87.59760650828957, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 30.193169363488664, Y: 76.9786342131348, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.318985625426677, Y: 61.35025093432557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.06246467647108, Y: 43.85215588221001, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.475140869632355, Y: 27.999668219213277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 43.06782794840302, Y: 16.97750911000321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 60.109792469254586, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 77.1773506387747, Y: 16.866211528120402, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 90.84167696993597, Y: 27.799432433491916, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 98.35764589046921, Y: 43.60320871119541, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 98.21531991907418, Y: 61.10260517987365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 90.44329195189557, Y: 76.78204122609407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 99.23824842582657, Y: 94.74446702612624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 108.03320489975758, Y: 112.70689282615831, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 121.14437221283796, Y: 124.29772073827974, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 122.25949291348729, Y: 141.76215619502966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 131.05438643437998, Y: 159.72461281866998, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 139.84927995527264, Y: 177.68706944231036, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 148.64417347616532, Y: 195.64952606595062, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 157.439066997058, Y: 213.611982689591, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.23396051795066, Y: 231.57443931323127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 181.75194438217642, Y: 239.66407322272488, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 189.4474793327019, Y: 255.38122124090052, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 186.3210109766491, Y: 272.59967632893324, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 195.1159116283857, Y: 290.56212946112214, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.2500077476446, Y: 294.1220101018177, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 226.07308548234224, Y: 304.85385625895697, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 233.7686252823612, Y: 320.5710019026903, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 233.76862335639993, Y: 338.07100190269017, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 226.07308009688248, Y: 353.7881458525589, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 364.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.25, Y: 384.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 404.5199889671022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 404.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.75, Y: 404.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.25, Y: 404.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.75, Y: 404.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.25, Y: 404.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 404.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 384.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.75, Y: 364.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.75, Y: 344.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 331.2012656127609, Y: 327.38354429951113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 342.24998212006705, Y: 313.8123573529773, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 359.750017879933, Y: 313.8123573529773, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 370.7987343872391, Y: 327.38354429951113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 367.25, Y: 344.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 367.25, Y: 364.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.25, Y: 384.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.25, Y: 404.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 384.75, Y: 404.5199889671023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 424.5199889671022, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 424.5199889671022, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 110.358212510816, Y: 265.8328262970198, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 43.5710343524041, Y: 105.4217622201478, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 114.13474145469326, Y: 39.27972182840489, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 171.65152362069836, Y: 204.81708916869837, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 237.8370829822466, Y: 366.4101787503497, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 316.85786437626905, Y: 418.66212459083323, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 383.5, Y: 384.5199889671023, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '82', X: 381.0, Y: 424.5199889671023, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLASP1, -11.3 ± 1.1
 kcal/mol, AUC: 0.588', X: 128.75, Y: 437.3199889671023, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 401.5, 437.3199889671023)
Updated viewBox: -0.25 0.0 406.75 442.3199889671023
Updated SVG: /disk1/www/rails/humanrnamap/public/result/41b179a0-8a84-4814-b15f-c4b0e17bd8a8/final_image/CLASP1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/41b179a0-8a84-4814-b15f-c4b0e17bd8a8/final_image/CLASP1_fold_final_1.svg
