Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 53% [===========================                       ] -                     
 59% [==============================                    ] \                     
 65% [=================================                 ] |                     
 71% [====================================              ] /                     
 77% [=======================================           ] -                     
 83% [==========================================        ] \                     
 89% [=============================================     ] |                     
 95% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/424e58be-8262-44a2-8503-4b4920c3aad0/final_image/TEX2_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.12 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.12 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.12 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.68 MB
Based on canonical annotations, the following gene is in your area of interest: TEX2(-)
write fasta - Elapsed time since the previous call: 0.58 seconds
write fasta - Current memory usage: 171.68 MB
Length of region: 84 nt.
98.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.34 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/424e58be-8262-44a2-8503-4b4920c3aad0/fasta/TEX2.fasta" "/disk1/www/rails/humanrnamap/public/result/424e58be-8262-44a2-8503-4b4920c3aad0/ct/TEX2.ct" --SHAPE "TEX2.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 175.34 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/424e58be-8262-44a2-8503-4b4920c3aad0/ct/TEX2.ct" "/disk1/www/rails/humanrnamap/public/result/424e58be-8262-44a2-8503-4b4920c3aad0/fold_FE/TEX2.txt" -sh "TEX2.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 175.34 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/424e58be-8262-44a2-8503-4b4920c3aad0/ct/TEX2.ct" 1 "/disk1/www/rails/humanrnamap/public/result/424e58be-8262-44a2-8503-4b4920c3aad0/fold_dbn/TEX2_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.34 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGUUCUUCCUCCCCAUUGUCCUCUCCUUCUAAGUCUCCCAUCCUCUCAUCCAGUGCCUCAACCUCCACCCUUUCCAGUGCAAAA', '-structureDBN', '.................................................................(((........))).....', '-o', '/disk1/www/rails/humanrnamap/public/result/424e58be-8262-44a2-8503-4b4920c3aad0/final_image/TEX2_fold_1.svg', '-title', 'TEX2, -1.4 ± 0.4\n kcal/mol, AUC: 0.73', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,6,7,10,16,17,18,19,22,24,27,28,30,33,34,36,41,44,46,49,53,54,55,58,64,71,72,73,77,78,79,81', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '67,69,38,8,9,11,12,50,20,21,57,26', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,65,66,68,5,75,13,83,37,39,40,43,47,51,56,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '70,74,76,14,15,80,82,84,23,25,29,31,32,35,42,45,48,52,59,61,62,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 108.83506218665306, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 108.83506218665306, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 108.83506218665306, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 108.83506218665306, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 108.83506218665308, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 108.83506218665308, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 108.83506218665308, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 108.83506218665308, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 108.83506218665308, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 108.83506218665308, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.25, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 267.25, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.75, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.25, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.75, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 337.25, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 354.75, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 372.25, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 389.75, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 407.25, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 424.75, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 442.25, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 459.75, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 477.25, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 494.75, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 512.25, Y: 108.83506218665309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 529.75, Y: 108.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 547.25, Y: 108.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 564.75, Y: 108.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 582.25, Y: 108.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 599.75, Y: 108.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 617.25, Y: 108.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 634.75, Y: 108.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 652.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 669.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 687.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 704.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 722.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 739.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 757.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 774.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 792.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 809.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 827.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 844.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 862.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 879.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 897.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 914.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 932.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 949.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 967.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 984.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1002.25, Y: 108.83506218665313, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1019.75, Y: 108.83506218665313, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1037.25, Y: 108.83506218665313, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1054.75, Y: 108.83506218665313, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1072.25, Y: 108.83506218665313, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1089.75, Y: 108.83506218665313, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1107.25, Y: 108.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1124.75, Y: 108.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1142.25, Y: 108.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1142.25, Y: 88.83506218665313, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1142.25, Y: 68.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1130.5949319257163, Y: 55.780947998472996, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1127.9117893094517, Y: 38.487849526683235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1135.0632453932953, Y: 22.515774366107237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1149.7499927277997, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1167.2500072722003, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1181.9367546067047, Y: 22.515774366107266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1189.0882106905483, Y: 38.48784952668326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1186.4050680742837, Y: 55.78094799847301, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 1174.75, Y: 68.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1174.75, Y: 88.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 1174.75, Y: 108.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1192.25, Y: 108.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1209.75, Y: 108.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1227.25, Y: 108.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1244.75, Y: 108.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1262.25, Y: 108.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 128.83506218665306, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 128.8350621866531, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 128.8350621866531, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 508.5, Y: 128.8350621866531, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 683.5, Y: 128.83506218665312, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 858.5, Y: 128.83506218665312, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 1033.5, Y: 128.83506218665315, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 1104.339813393159, Y: 35.82528107236969, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 1188.5, Y: 128.83506218665315, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '84', X: 1258.5, Y: 128.83506218665315, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TEX2, -1.4 ± 0.4
 kcal/mol, AUC: 0.73', X: 572.0, Y: 141.63506218665316, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 5.0, 1276.5, 141.63506218665316)
Updated viewBox: -0.25 0.0 1281.75 146.63506218665316
Updated SVG: /disk1/www/rails/humanrnamap/public/result/424e58be-8262-44a2-8503-4b4920c3aad0/final_image/TEX2_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/424e58be-8262-44a2-8503-4b4920c3aad0/final_image/TEX2_fold_final_1.svg
