Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 46% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 63% [================================                  ] |                     
 69% [===================================               ] /                     
 75% [======================================            ] -                     
 81% [=========================================         ] \                     
 87% [============================================      ] |                     
 93% [===============================================   ] /                     
 98% [==================================================] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/4a60d0e7-76ff-42bf-b5bf-9aeda7095492/final_image/DNAJC13_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.05 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.05 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.05 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.75 MB
Based on canonical annotations, the following gene is in your area of interest: DNAJC13(+)
write fasta - Elapsed time since the previous call: 0.59 seconds
write fasta - Current memory usage: 172.75 MB
Length of region: 86 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 176.06 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/4a60d0e7-76ff-42bf-b5bf-9aeda7095492/fasta/DNAJC13.fasta" "/disk1/www/rails/humanrnamap/public/result/4a60d0e7-76ff-42bf-b5bf-9aeda7095492/ct/DNAJC13.ct" --SHAPE "DNAJC13.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.06 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/4a60d0e7-76ff-42bf-b5bf-9aeda7095492/ct/DNAJC13.ct" "/disk1/www/rails/humanrnamap/public/result/4a60d0e7-76ff-42bf-b5bf-9aeda7095492/fold_FE/DNAJC13.txt" -sh "DNAJC13.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 176.06 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/4a60d0e7-76ff-42bf-b5bf-9aeda7095492/ct/DNAJC13.ct" 1 "/disk1/www/rails/humanrnamap/public/result/4a60d0e7-76ff-42bf-b5bf-9aeda7095492/fold_dbn/DNAJC13_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.06 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAACAAAGAAAAACUGAUCAAUAAUGCCAUAACAGCAUUACUGUCCCAAGAAGGGGAUGUCGUUGCUUCAAAUGCGGAACUUGAGA', '-structureDBN', '.....................((((((.......)))))).((((((......))))))..(((((.......))..)))......', '-o', '/disk1/www/rails/humanrnamap/public/result/4a60d0e7-76ff-42bf-b5bf-9aeda7095492/final_image/DNAJC13_fold_1.svg', '-title', 'DNAJC13, -18.9 ± 0.8\n kcal/mol, AUC: 0.899', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '8,15,16,18,22,25,26,30,35,38,39,42,43,44,50,53,54,55,56,58,59,60,62,63,64,65,67,68,73,74,76,77,81,82,83,85', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '66,36,5,37,9,11,45,46,78,79,23,24,27', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '32,1,2,69,70,40,72,10,75,47,80', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '3,4,6,7,71,12,13,14,17,19,20,21,84,86,28,29,31,33,34,41,48,49,51,52,57,61']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 170.40989758732667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 170.40989758732667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 170.40989758732667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 170.40989758732667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 170.40989758732667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 170.40989758732667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 170.40989758732667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.25, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.75, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.25, Y: 170.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 354.75, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 372.25, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 372.25, Y: 150.4098975873267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 372.25, Y: 130.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 372.25, Y: 110.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 372.25, Y: 90.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 372.25, Y: 70.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 361.7979233435556, Y: 56.374076058242736, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 361.6508797232032, Y: 38.874688337462345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 371.86561713592346, Y: 24.66520798040287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 388.5, Y: 19.229446841445196, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 405.13438286407654, Y: 24.66520798040287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 415.3491202767968, Y: 38.8746883374624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 415.2020766564444, Y: 56.374076058242736, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 404.75, Y: 70.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 404.75, Y: 90.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 110.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 404.75, Y: 130.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 404.75, Y: 150.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 422.25, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 439.75, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 439.75, Y: 150.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 439.75, Y: 130.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 439.75, Y: 110.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 439.75, Y: 90.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 439.75, Y: 70.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 430.90309990849715, Y: 55.31084097474195, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 433.86830502339313, Y: 38.0639076112229, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 447.2500121168788, Y: 26.786537923071847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 464.7499878831212, Y: 26.786537923071847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 478.1316949766069, Y: 38.0639076112229, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 481.09690009150285, Y: 55.31084097474195, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 472.25, Y: 70.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 472.25, Y: 90.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 472.25, Y: 110.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.25, Y: 130.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 472.25, Y: 150.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 472.25, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 489.75, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 507.25, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 524.75, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 524.75, Y: 150.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 524.75, Y: 130.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 518.0716833066771, Y: 114.2870148524838, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 503.9295476829461, Y: 100.14487922875287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 486.6139888189533, Y: 97.61078892726692, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.13607755389546, Y: 85.34082874437189, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 471.311367728856, Y: 68.07029873418367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 479.22998909063057, Y: 52.46435024787456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 494.8359375769396, Y: 44.545728886099994, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 512.1064675871279, Y: 47.37043871113937, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 524.3764277700229, Y: 59.8483499761972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 526.9105180715089, Y: 77.16390884019006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 541.0526536952398, Y: 91.30604446392098, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 557.2252168200591, Y: 98.03396554654961, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 563.9283704339126, Y: 114.21680991178485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 557.25, Y: 130.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 557.25, Y: 150.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 557.25, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 574.75, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 592.25, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 609.75, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 627.25, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 644.75, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 662.25, Y: 170.40989758732672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 190.40989758732667, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 190.4098975873267, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 190.4098975873267, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 356.30559589465287, Y: 8.5244707518641, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 415.14213562373095, Y: 184.55203321105768, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 436.6395461804439, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 486.0, Y: 190.40989758732672, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 461.3378534668996, Y: 38.32221462414364, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 567.642135623731, Y: 184.55203321105768, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '86', X: 658.5, Y: 190.40989758732672, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'DNAJC13, -18.9 ± 0.8
 kcal/mol, AUC: 0.899', X: 265.25, Y: 203.20989758732674, Width: 147.0, Height: 23
Calculated bounding box: (4.75, 0.0, 676.5, 203.20989758732674)
Updated viewBox: -0.25 -5.0 681.75 213.20989758732674
Updated SVG: /disk1/www/rails/humanrnamap/public/result/4a60d0e7-76ff-42bf-b5bf-9aeda7095492/final_image/DNAJC13_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/4a60d0e7-76ff-42bf-b5bf-9aeda7095492/final_image/DNAJC13_fold_final_1.svg
