Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 57% [=============================                     ] \                     
 63% [================================                  ] |                     
 68% [===================================               ] /                     
 74% [======================================            ] -                     
 80% [=========================================         ] \                     
 86% [============================================      ] |                     
 91% [==============================================    ] /                     
 97% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/4ab9c075-96ab-485a-b7ea-bbf3e8076218/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.17 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.17 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.17 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.87 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.34 seconds
write fasta - Current memory usage: 172.87 MB
Length of region: 87 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 176.46 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/4ab9c075-96ab-485a-b7ea-bbf3e8076218/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/4ab9c075-96ab-485a-b7ea-bbf3e8076218/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.46 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/4ab9c075-96ab-485a-b7ea-bbf3e8076218/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/4ab9c075-96ab-485a-b7ea-bbf3e8076218/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 176.46 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/4ab9c075-96ab-485a-b7ea-bbf3e8076218/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/4ab9c075-96ab-485a-b7ea-bbf3e8076218/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.46 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAAAGAAAAUUGGUACUUACCCUUCUACAAAAGAAGUGUGACUAGAUAUCAAUCAGUAAUUAACAUAUCAAGGAGCUCUUCUAGCUA', '-structureDBN', '...((((....(((....))).)))).....(((((.((..((.(((((...............))))).))..)).))))).....', '-o', '/disk1/www/rails/humanrnamap/public/result/4ab9c075-96ab-485a-b7ea-bbf3e8076218/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -15.4 ± 0.9\n kcal/mol, AUC: 0.685', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,10,11,12,13,14,17,18,23,24,26,33,36,37,38,39,40,43,45,47,49,53,56,57,60,61,66,68,72,73,75,77,79,80,82,84,86', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '34,35,7,19,51,21,25,30', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,2,65,69,70,71,8,15,81,83,20,22,87,31,32,44,46,48,55,62,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,3,4,67,6,9,74,76,78,16,85,27,28,29,41,42,50,52,54,58,59']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 400.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 380.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 360.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 45.88522174812712, Y: 348.1305880192232, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 43.01722819079916, Y: 331.3593449394649, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 49.52847159830745, Y: 315.63981279714596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 63.415509001718476, Y: 305.80873077930676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 80.40544109379726, Y: 304.8910222243894, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 94.54757671752822, Y: 290.74888660065847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 108.68971234125917, Y: 276.6067509769275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 118.29767442129429, Y: 261.98012059719906, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 135.70657510566258, Y: 260.19646464427854, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 148.08096906247087, Y: 272.5708586010869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 146.2973131095504, Y: 289.9797592854552, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 131.67068272982198, Y: 299.5877213654903, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 117.52854710609103, Y: 313.7298569892213, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 103.38641148236006, Y: 327.8719926129522, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 101.83890656955339, Y: 346.5157931506825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 360.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 380.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 400.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 400.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 380.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 360.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 340.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 188.07162284851074, Y: 324.6176657256833, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 308.4421292956006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 288.4421292956006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 184.37031668259823, Y: 274.3526900744695, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 184.37031668259823, Y: 256.8526865505986, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 242.76324732946748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 222.76324732946748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 188.07162284851074, Y: 206.58771089938475, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 190.412174469302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 170.41217446930193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 150.41217446930193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 130.41217446930193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 110.41217446930204, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.44525971278424, Y: 101.92597820062167, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 167.99649507159157, Y: 88.6905563879152, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 161.80274017499687, Y: 72.32327186510577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 161.6208691985224, Y: 54.82419973777269, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 167.47310669700906, Y: 38.33171906835878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.64431177360558, Y: 24.861203877531352, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 193.76936798875323, Y: 16.058745308568177, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 211.0, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 228.23063201124674, Y: 16.058745308568177, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 243.35568822639436, Y: 24.861203877531352, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 254.52689330299097, Y: 38.331719068358666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 260.3791308014776, Y: 54.82419973777269, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 260.19725982500313, Y: 72.32327186510577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 254.00350492840846, Y: 88.6905563879152, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 242.55474028721574, Y: 101.92597820062167, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 110.41217446930204, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 130.41217446930193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 150.41217446930193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 170.41217446930193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.25, Y: 190.412174469302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 233.92837715148926, Y: 206.58771089938475, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 222.76324732946748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.25, Y: 242.76324732946748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 237.62968331740177, Y: 256.8526865505986, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 237.62968331740177, Y: 274.3526900744695, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.25, Y: 288.4421292956006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.25, Y: 308.4421292956006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 233.92837715148926, Y: 324.6176657256833, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.25, Y: 340.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 360.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 380.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.25, Y: 400.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 420.79320215576604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 420.7932021557661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.25, Y: 420.7932021557661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 279.75, Y: 420.7932021557661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 297.25, Y: 420.7932021557661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 314.75, Y: 420.7932021557661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 440.79320215576604, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 30.148507612942723, Y: 303.16166286151037, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 127.92068272982198, Y: 327.8719926129522, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 156.0, Y: 440.79320215576604, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 161.61973432038775, Y: 280.5959159951659, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 163.08886311212055, Y: 117.45268953131801, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 268.1662704544989, Y: 28.451963895146378, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 250.17837715148926, Y: 206.58771089938475, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 243.5, Y: 380.79320215576604, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '87', X: 311.0, Y: 440.7932021557661, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -15.4 ± 0.9
 kcal/mol, AUC: 0.685', X: 93.75, Y: 453.5932021557661, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 329.0, 453.5932021557661)
Updated viewBox: -0.25 0.0 334.25 458.5932021557661
Updated SVG: /disk1/www/rails/humanrnamap/public/result/4ab9c075-96ab-485a-b7ea-bbf3e8076218/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/4ab9c075-96ab-485a-b7ea-bbf3e8076218/final_image/CLOCK_fold_final_1.svg
