Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 16% [=========                                         ] |                     
 21% [===========                                       ] /                     
 27% [==============                                    ] -                     
 32% [=================                                 ] \                     
 38% [====================                              ] |                     
 43% [======================                            ] /                     
 48% [=========================                         ] -                     
 54% [============================                      ] \                     
 59% [==============================                    ] |                     
 65% [=================================                 ] /                     
 70% [====================================              ] -                     
 76% [=======================================           ] \                     
 81% [=========================================         ] |                     
 86% [============================================      ] /                     
 92% [===============================================   ] -                     
 97% [================================================= ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/4f69c06e-b687-4813-90d9-c2fe0d36d9bd/final_image/TGOLN2_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.16 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.16 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.16 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.78 MB
Based on canonical annotations, the following gene is in your area of interest: TGOLN2(-)
write fasta - Elapsed time since the previous call: 0.77 seconds
write fasta - Current memory usage: 172.78 MB
Length of region: 92 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.32 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/4f69c06e-b687-4813-90d9-c2fe0d36d9bd/fasta/TGOLN2.fasta" "/disk1/www/rails/humanrnamap/public/result/4f69c06e-b687-4813-90d9-c2fe0d36d9bd/ct/TGOLN2.ct" --SHAPE "TGOLN2.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.32 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/4f69c06e-b687-4813-90d9-c2fe0d36d9bd/ct/TGOLN2.ct" "/disk1/www/rails/humanrnamap/public/result/4f69c06e-b687-4813-90d9-c2fe0d36d9bd/fold_FE/TGOLN2.txt" -sh "TGOLN2.dat"

efn2 - Elapsed time since the previous call: 0.51 seconds
efn2 - Current memory usage: 176.32 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/4f69c06e-b687-4813-90d9-c2fe0d36d9bd/ct/TGOLN2.ct" 1 "/disk1/www/rails/humanrnamap/public/result/4f69c06e-b687-4813-90d9-c2fe0d36d9bd/fold_dbn/TGOLN2_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.03 seconds
ct2dot - Current memory usage: 176.32 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAACUAAACUUUUCUAAAGGUUACCAGUUAUCCAAUCACCAAAUCCAUGGCUUUUUCUCAAAGCUUAGUCUUGUCCUUGGCAGAACUGGACA', '-structureDBN', '......((((((....)))))).((((((..((((..(.(((......((((((.....)))))).....))))..))))...))))))...', '-o', '/disk1/www/rails/humanrnamap/public/result/4f69c06e-b687-4813-90d9-c2fe0d36d9bd/final_image/TGOLN2_fold_1.svg', '-title', 'TGOLN2, -15.4 ± 1.2\n kcal/mol, AUC: 0.47', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,10,11,12,13,15,19,20,21,22,27,28,29,31,36,44,48,49,50,52,53,54,55,56,58,63,65,66,68,69,71,72,73,74,77,78,79,80,83,87,88,89', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '64,75,76,14,51,62,90,60,61,30', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,34,38,6,41,43,47,16,81,82,84,86,57,91', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,3,4,67,70,7,8,9,17,18,85,23,24,25,26,92,32,33,35,37,39,40,42,45,46,59']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 525.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 505.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 485.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 465.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 445.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 106.20126561276089, Y: 428.5402135665536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 117.24998212006702, Y: 414.9690266200198, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 134.75001787993298, Y: 414.9690266200198, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 145.7987343872391, Y: 428.5402135665536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 445.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 465.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 485.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 505.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 142.25, Y: 525.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 142.25, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.25, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.25, Y: 525.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 505.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.25, Y: 485.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 465.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 445.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 165.6688475784504, Y: 432.5570001631189, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 163.1464749042966, Y: 415.2397788096661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 170.503890685691, Y: 399.3615877183772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 164.79865677535167, Y: 380.19259436900404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.09342286501234, Y: 361.0236010196308, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 153.388188954673, Y: 341.8546076702576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 139.42060549458495, Y: 331.3115123488405, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 134.4285271418862, Y: 314.5386354223401, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 140.35776048567146, Y: 298.07368967004686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 131.8286943886008, Y: 282.79274397486427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 138.1590237909818, Y: 266.47774475682354, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 141.15420665064192, Y: 246.70329458400704, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.14938951030206, Y: 226.92884441119065, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 130.66170337426644, Y: 215.77850509161362, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 122.19010976024765, Y: 200.46577032982714, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 119.90989969537196, Y: 183.115024342811, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.13741394754123, Y: 166.13339110293634, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 134.28615606827134, Y: 151.87678640150648, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 148.9481589034988, Y: 142.32307418553023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 166.0893163384748, Y: 138.79767122483509, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 172.71470540896777, Y: 119.92694734723591, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.34009447946076, Y: 101.05622346963673, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 185.96548354995375, Y: 82.18549959203756, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.59087262044673, Y: 63.31477571443838, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 199.21626169093972, Y: 44.44405183683921, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 198.30607630944297, Y: 26.967714394200357, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 210.0044194745315, Y: 13.952355197101951, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.47850964873567, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 240.52206043393574, Y: 24.66690150603722, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 241.51657990093827, Y: 42.13864265760594, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.88118799203838, Y: 55.21030907639033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 223.2557989215454, Y: 74.0810329539895, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 216.6304098510524, Y: 92.95175683158868, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 210.00502078055942, Y: 111.82248070918786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 203.37963171006643, Y: 130.69320458678703, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 196.75424263957345, Y: 149.5639284643862, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 207.92947624904843, Y: 163.0310793796191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 213.40115739024841, Y: 179.65367561152698, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.41017680822665, Y: 197.12559472437943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 205.09401739203912, Y: 213.02288415990677, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 192.4676805973948, Y: 225.14004633379102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 176.28287104112871, Y: 231.79601655813838, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 173.28768818146858, Y: 251.57046673095476, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 170.29250532180842, Y: 271.34491690377115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 171.50737835886014, Y: 288.8026969317084, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 185.47495340350488, Y: 299.34579170374843, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 190.4670297457542, Y: 316.11866187534264, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 184.53780314740447, Y: 332.5836025659562, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 190.2430370577438, Y: 351.7525959153294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 195.94827096808314, Y: 370.9215892647026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 201.65350487842247, Y: 390.09058261407586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 216.49602168242683, Y: 399.3614884448373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 223.85351237168118, Y: 415.2396914526571, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 221.33117097893486, Y: 432.5569601142688, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 445.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 465.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 209.75, Y: 485.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 209.75, Y: 505.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.75, Y: 525.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.75, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 244.75, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.25, Y: 545.6766582341447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 565.6766582341447, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 86.0, Y: 485.6766582341447, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 158.5, Y: 505.6766582341447, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 143.772323805302, Y: 440.96554789447896, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 114.42536234772592, Y: 265.66949026637616, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 150.0939815313686, Y: 113.30155827674292, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 245.00989206261823, Y: 61.81292466534228, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 199.6362022650893, Y: 241.89671320378892, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 215.39501262796296, Y: 380.39279128574935, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 223.5, Y: 565.6766582341447, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '92', X: 258.5, Y: 565.6766582341447, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TGOLN2, -15.4 ± 1.2
 kcal/mol, AUC: 0.47', X: 69.75, Y: 578.4766582341447, Width: 138.0, Height: 23
Calculated bounding box: (4.75, 5.0, 276.5, 578.4766582341447)
Updated viewBox: -0.25 0.0 281.75 583.4766582341447
Updated SVG: /disk1/www/rails/humanrnamap/public/result/4f69c06e-b687-4813-90d9-c2fe0d36d9bd/final_image/TGOLN2_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/4f69c06e-b687-4813-90d9-c2fe0d36d9bd/final_image/TGOLN2_fold_final_1.svg
