Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 57% [=============================                     ] \                     
 63% [================================                  ] |                     
 68% [===================================               ] /                     
 74% [======================================            ] -                     
 80% [=========================================         ] \                     
 86% [============================================      ] |                     
 91% [==============================================    ] /                     
 97% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/51275a66-69f9-45cb-aeb2-0cb8cd26cdda/final_image/SON_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.77 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.77 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.77 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.39 MB
Based on canonical annotations, the following gene is in your area of interest: SON(+)
write fasta - Elapsed time since the previous call: 0.13 seconds
write fasta - Current memory usage: 172.39 MB
Length of region: 87 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 175.78 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/51275a66-69f9-45cb-aeb2-0cb8cd26cdda/fasta/SON.fasta" "/disk1/www/rails/humanrnamap/public/result/51275a66-69f9-45cb-aeb2-0cb8cd26cdda/ct/SON.ct" --SHAPE "SON.dat"

fold - Elapsed time since the previous call: 0.12 seconds
fold - Current memory usage: 175.78 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/51275a66-69f9-45cb-aeb2-0cb8cd26cdda/ct/SON.ct" "/disk1/www/rails/humanrnamap/public/result/51275a66-69f9-45cb-aeb2-0cb8cd26cdda/fold_FE/SON.txt" -sh "SON.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 175.78 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/51275a66-69f9-45cb-aeb2-0cb8cd26cdda/ct/SON.ct" 1 "/disk1/www/rails/humanrnamap/public/result/51275a66-69f9-45cb-aeb2-0cb8cd26cdda/fold_dbn/SON_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.78 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AUGAUUAUGAAAUUUUUGUAAAAGUUAAGGACACUCACGAAAAAAGCAAGAAAAAUAAGAACCGUGAUAAGGGGGAGAAAGAGAAGA', '-structureDBN', '............(((((((....(((...)))....)))))))..................((........))..............', '-o', '/disk1/www/rails/humanrnamap/public/result/51275a66-69f9-45cb-aeb2-0cb8cd26cdda/final_image/SON_fold_1.svg', '-title', 'SON, -3.0 ± 0.6\n kcal/mol, AUC: 0.485', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,5,6,8,9,13,14,15,16,17,18,19,24,25,26,29,30,35,39,46,50,56,59,64,65,66,68,71,72,73,74,75,77,81,83,86', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '51,40,41,10,31', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '42,11,12,45,53,85,57,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,4,7,20,21,22,23,27,28,32,33,34,36,37,38,43,44,47,48,49,52,54,55,58,61,62,63,67,69,70,76,78,79,80,82,84,87']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 144.75, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 249.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 229.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 209.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 189.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 169.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 149.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 200.92691882602546, Y: 138.6179638490775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 193.23137587321534, Y: 122.90081789778651, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 193.23137587321534, Y: 105.4008162351372, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 200.92691882602546, Y: 89.6836702838462, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 78.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 58.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 38.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 215.69020113855714, Y: 21.477077958505106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 231.0, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 246.30979886144286, Y: 21.477077958505106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 38.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 58.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 78.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 261.0730811739746, Y: 89.6836702838462, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 268.76862412678463, Y: 105.4008162351372, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 268.7686241267847, Y: 122.90081789778651, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 261.0730811739746, Y: 138.6179638490775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 149.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 169.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 189.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 209.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 229.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 249.34980828749718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 269.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 299.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 369.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 387.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 422.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 492.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 509.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 527.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 544.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 562.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 579.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 579.75, Y: 249.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 568.0949319257163, Y: 236.29569409931707, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 565.4117893094517, Y: 219.0025956275273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 572.5632453932953, Y: 203.03052046695132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 587.2499927277997, Y: 193.5147461008441, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 604.7500072722003, Y: 193.5147461008441, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 619.4367546067047, Y: 203.03052046695132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 626.5882106905483, Y: 219.0025956275273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 623.9050680742837, Y: 236.29569409931707, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 612.25, Y: 249.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 612.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 629.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 647.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 664.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 682.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 699.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 717.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 734.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 752.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 769.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 787.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 804.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 822.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 839.75, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 857.25, Y: 269.34980828749724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 289.3498082874972, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 289.3498082874972, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 181.66291538501454, Y: 151.2399960639113, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 262.7226744645939, Y: 33.43016065924871, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 263.5, Y: 209.34980828749718, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 366.0, Y: 289.34980828749724, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 541.0, Y: 289.34980828749724, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 642.6601866068412, Y: 216.3400271732138, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 731.0, Y: 289.34980828749724, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '87', X: 853.5, Y: 289.34980828749724, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'SON, -3.0 ± 0.6
 kcal/mol, AUC: 0.485', X: 365.0, Y: 302.14980828749725, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 871.5, 302.14980828749725)
Updated viewBox: -0.25 0.0 876.75 307.14980828749725
Updated SVG: /disk1/www/rails/humanrnamap/public/result/51275a66-69f9-45cb-aeb2-0cb8cd26cdda/final_image/SON_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/51275a66-69f9-45cb-aeb2-0cb8cd26cdda/final_image/SON_fold_final_1.svg
