Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/53069014-8f71-4ffe-b0d5-19f044c90beb/final_image/NFKB1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.87 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.87 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.87 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.42 MB
Based on canonical annotations, the following gene is in your area of interest: NFKB1(+)
write fasta - Elapsed time since the previous call: 0.34 seconds
write fasta - Current memory usage: 172.42 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 176.09 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/53069014-8f71-4ffe-b0d5-19f044c90beb/fasta/NFKB1.fasta" "/disk1/www/rails/humanrnamap/public/result/53069014-8f71-4ffe-b0d5-19f044c90beb/ct/NFKB1.ct" --SHAPE "NFKB1.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 176.09 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/53069014-8f71-4ffe-b0d5-19f044c90beb/ct/NFKB1.ct" "/disk1/www/rails/humanrnamap/public/result/53069014-8f71-4ffe-b0d5-19f044c90beb/fold_FE/NFKB1.txt" -sh "NFKB1.dat"

efn2 - Elapsed time since the previous call: 0.52 seconds
efn2 - Current memory usage: 176.09 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/53069014-8f71-4ffe-b0d5-19f044c90beb/ct/NFKB1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/53069014-8f71-4ffe-b0d5-19f044c90beb/fold_dbn/NFKB1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.09 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAGUACUACCUACGAUGGAACCACACCCCUGCAUAUAGCAGCUGGGAGAGGGUCCACCAGGCUGGCAGCUCUUCUCAAAGCAGCA', '-structureDBN', '.....((((((....(((.(((...(((((((.....))))..)))....))))))..))).)))..((((((....))).))).', '-o', '/disk1/www/rails/humanrnamap/public/result/53069014-8f71-4ffe-b0d5-19f044c90beb/final_image/NFKB1_fold_1.svg', '-title', 'NFKB1, -28.8 ± 0.9\n kcal/mol, AUC: 0.756', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,7,11,14,16,17,18,30,31,34,36,38,41,43,44,45,46,48,50,51,52,53,60,61,63,64,65,68,70,72,73,75,80,83', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '69,10,74,76,82,20,21,85,27,28,29,32,39,40,54,55,56,57,58,59', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '35,71,8,9,42,47,49,19,22,23,24,25,26', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,66,67,5,6,12,13,77,15,78,79,81,84,33,37,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 463.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 443.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 88.43439675932204, Y: 426.8314153824546, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 79.92290491375286, Y: 408.7329484152552, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 71.41141306818369, Y: 390.63448144805574, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 55.38891896870935, Y: 385.223893948141, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 44.08019736360039, Y: 372.64980988924964, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 40.39296089685668, Y: 356.1452934922074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 45.27527642078486, Y: 339.9540066567908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.471796861095925, Y: 328.2390733061056, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.471796861095925, Y: 308.2390733061055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.471796861095925, Y: 288.2390733061055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 53.65617799451326, Y: 271.16004164467057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 64.37751895365273, Y: 257.32873231166815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 72.88913696890054, Y: 239.23032468109164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 81.40075498414836, Y: 221.1319170505152, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.2898427937775, Y: 205.1416836090869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 75.54652530112679, Y: 187.6867878269215, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 84.87469218057419, Y: 172.88010216267804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 100.07636063537022, Y: 164.2105050624089, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 103.94095456012343, Y: 144.58743410506992, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.80554848487662, Y: 124.96436314773092, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 104.37860574878798, Y: 107.80333566651126, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 93.2737616881225, Y: 91.16956163930087, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 82.16891762745703, Y: 74.53578761209025, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 71.06407356679156, Y: 57.90201358487985, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 56.5465828629644, Y: 48.129947708006114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 53.170340189930485, Y: 30.958698678000985, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 62.907345195568894, Y: 16.417669094170435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 80.07039695801544, Y: 13.000000000000057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 94.63488074729254, Y: 22.70188743438888, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 98.09395636100865, Y: 39.856641986298484, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.19880042167412, Y: 56.49041601350888, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 120.30364448233959, Y: 73.1241900407195, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 131.40848854300503, Y: 89.75796406792989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 145.94418215482483, Y: 99.50289152909153, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 149.3711539812574, Y: 116.664064685401, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 139.69303879055246, Y: 131.24432827545485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 135.82844486579927, Y: 150.86739923279384, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 131.96385094104608, Y: 170.49047019013284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.74299350073838, Y: 184.27669830654776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 145.7602783184113, Y: 201.51462139284325, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 140.30475295417833, Y: 218.14252694345942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.6618840785527, Y: 230.24243878585463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 110.81066738383515, Y: 234.9632963252929, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 102.29904936858733, Y: 253.0617039558694, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 93.7874313533395, Y: 271.16011158644585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.97179686109592, Y: 288.2390733061055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.97179686109592, Y: 308.2390733061055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.97179686109592, Y: 328.2390733061055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 102.98231592557565, Y: 341.35984297692903, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.01107816257272, Y: 359.3930700292272, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 100.82142188988277, Y: 376.8033071990058, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 109.33291373545197, Y: 394.90177416620526, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 117.84440558102114, Y: 413.0002411334047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 128.5656344922436, Y: 426.8315552659508, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.75, Y: 443.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 463.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.25, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.25, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.25, Y: 463.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 443.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 173.43439675932206, Y: 426.8314153824546, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 164.9229049137529, Y: 408.7329484152552, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 156.41141306818372, Y: 390.63448144805574, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 145.90724501153068, Y: 376.6375637504276, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 150.12993419689636, Y: 359.65462679475405, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 165.9661251531335, Y: 352.2070562113906, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 181.73991904151092, Y: 359.78588712147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 185.8214218898828, Y: 376.8033071990058, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.33291373545197, Y: 394.90177416620526, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 202.84440558102114, Y: 413.0002411334047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 213.56563449224356, Y: 426.8315552659508, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 443.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.75, Y: 463.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 209.75, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 483.91051698561046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 503.91051698561046, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 58.07443794655342, Y: 417.2444402608244, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 41.70474676433193, Y: 250.85349543020448, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 72.889987660912, Y: 102.27440569996634, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 133.1874185095501, Y: 62.01934598005403, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 133.8200085364774, Y: 247.61566732076648, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 123.68138070265141, Y: 386.39028232063606, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 153.5, Y: 443.91051698561046, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 218.01721162570888, Y: 406.52510318930433, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 223.5, Y: 503.91051698561046, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'NFKB1, -28.8 ± 0.9
 kcal/mol, AUC: 0.756', X: 50.0, Y: 516.7105169856104, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.000000000000057, 241.5, 516.7105169856104)
Updated viewBox: -0.25 5.684341886080802e-14 246.75 521.7105169856104
Updated SVG: /disk1/www/rails/humanrnamap/public/result/53069014-8f71-4ffe-b0d5-19f044c90beb/final_image/NFKB1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/53069014-8f71-4ffe-b0d5-19f044c90beb/final_image/NFKB1_fold_final_1.svg
