Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 19% [==========                                        ] |                     
 25% [=============                                     ] /                     
 32% [=================                                 ] -                     
 38% [====================                              ] \                     
 45% [=======================                           ] |                     
 51% [==========================                        ] /                     
 58% [==============================                    ] -                     
 64% [=================================                 ] \                     
 71% [====================================              ] |                     
 77% [=======================================           ] /                     
 84% [===========================================       ] -                     
 90% [==============================================    ] \                     
 97% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/55da5134-7c77-4572-b2d3-18c9f51256ca/final_image/ADAR_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.95 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.95 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.95 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.67 MB
Based on canonical annotations, the following gene is in your area of interest: ADAR(-)
write fasta - Elapsed time since the previous call: 0.99 seconds
write fasta - Current memory usage: 172.67 MB
Length of region: 77 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 176.25 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/55da5134-7c77-4572-b2d3-18c9f51256ca/fasta/ADAR.fasta" "/disk1/www/rails/humanrnamap/public/result/55da5134-7c77-4572-b2d3-18c9f51256ca/ct/ADAR.ct" --SHAPE "ADAR.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 176.25 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/55da5134-7c77-4572-b2d3-18c9f51256ca/ct/ADAR.ct" "/disk1/www/rails/humanrnamap/public/result/55da5134-7c77-4572-b2d3-18c9f51256ca/fold_FE/ADAR.txt" -sh "ADAR.dat"

efn2 - Elapsed time since the previous call: 0.44 seconds
efn2 - Current memory usage: 176.25 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/55da5134-7c77-4572-b2d3-18c9f51256ca/ct/ADAR.ct" 1 "/disk1/www/rails/humanrnamap/public/result/55da5134-7c77-4572-b2d3-18c9f51256ca/fold_dbn/ADAR_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.25 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGGAUGCAAAUCAAGAGAAAUACGAACAGUGUUCCUGAAACCGCUCCAGCUGCAAUCCCUGAGACCAAAAGAAACGC', '-structureDBN', '.(((.((......((.(((.(((.....))))))))......)))))..............................', '-o', '/disk1/www/rails/humanrnamap/public/result/55da5134-7c77-4572-b2d3-18c9f51256ca/final_image/ADAR_fold_1.svg', '-title', 'ADAR, -7.7 ± 0.5\n kcal/mol, AUC: 0.673', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,5,6,71,11,76,15,17,21,24,29,30,31,32,33,36,37,43,45,49,51,52,56,60,61,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '35,68', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '34,4,8,44,77,46,47,18,50,26', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,7,9,10,12,13,14,16,19,20,22,23,25,27,28,38,39,40,41,42,48,53,54,55,57,58,59,62,64,65,66,67,69,70,72,73,74,75']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 280.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 260.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 18.434381133417332, Y: 243.53892811898862, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 29.1557220925568, Y: 229.70761878598623, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 37.66734010780456, Y: 211.60921115540972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 27.477847979212243, Y: 197.38163336345866, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.84716311151891, Y: 180.50542296773355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 24.348592680895877, Y: 163.06995827897734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 31.79625050177151, Y: 147.23385671805605, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 44.26807087622626, Y: 134.95772474532126, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 60.219965980344966, Y: 127.7614227608394, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 77.67699340322744, Y: 126.5358970689858, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 86.18860105563397, Y: 108.4374845648048, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.43154187169256, Y: 92.13423203676527, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 103.67056659734465, Y: 83.55735131054817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 117.81270222107557, Y: 69.41521568681719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 131.95483784480652, Y: 55.27308006308624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 141.33348697372304, Y: 40.49833098420186, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 158.6948324913984, Y: 38.29925125776765, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.5109620731087, Y: 31.520367310959955, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 196.327091654819, Y: 24.74148336415226, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.3035463419437, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 226.7828088690676, Y: 13.85216743985518, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 238.55557176431398, Y: 26.80025075940398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 237.74558632985816, Y: 44.28151877501534, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 224.8259497764817, Y: 56.085492646823354, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 207.34277806838148, Y: 55.31769393443142, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 188.52664848667118, Y: 62.096577881239114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 169.71051890496088, Y: 68.87546182804681, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 154.93580823336933, Y: 78.254050451649, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 140.79367260963838, Y: 92.39618607537997, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 126.65153698590743, Y: 106.53832169911092, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 115.59852137492805, Y: 122.2688469999654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 107.08691372252156, Y: 140.36725950414635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 117.27641749743867, Y: 154.5948388070689, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 121.90711000628721, Y: 171.47105541176134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 120.40568260207846, Y: 188.9065283261933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 112.95802137247938, Y: 204.74263713515037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 100.4861932814728, Y: 217.01877268622584, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 84.53428852176052, Y: 224.21507274508036, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 67.07725250749135, Y: 225.44059043018743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 58.56563449224356, Y: 243.5389980607639, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 54.75, Y: 260.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.75, Y: 280.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.75, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 72.25, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.25, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.75, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 300.6179597804236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.25, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 299.75, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.75, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 387.25, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 422.25, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.25, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 474.75, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 492.25, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 509.75, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 527.25, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 544.75, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 562.25, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 579.75, Y: 300.61795978042363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 320.6179597804236, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 1.2850187564289577, Y: 157.87516643866732, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 126.86509997532062, Y: 23.612947359525833, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 191.5555324334789, Y: 80.91270746294938, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 125.5266901418087, Y: 216.30555413722715, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 103.5, Y: 320.6179597804236, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 278.5, Y: 320.61795978042363, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 453.5, Y: 320.61795978042363, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '77', X: 576.0, Y: 320.61795978042363, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ADAR, -7.7 ± 0.5
 kcal/mol, AUC: 0.673', X: 226.25, Y: 333.41795978042364, Width: 142.5, Height: 23
Calculated bounding box: (1.2850187564289577, 5.0, 594.0, 333.41795978042364)
Updated viewBox: -3.7149812435710423 0.0 602.7149812435711 338.41795978042364
Updated SVG: /disk1/www/rails/humanrnamap/public/result/55da5134-7c77-4572-b2d3-18c9f51256ca/final_image/ADAR_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/55da5134-7c77-4572-b2d3-18c9f51256ca/final_image/ADAR_fold_final_1.svg
