Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 16% [=========                                         ] |                     
 21% [===========                                       ] /                     
 27% [==============                                    ] -                     
 32% [=================                                 ] \                     
 38% [====================                              ] |                     
 43% [======================                            ] /                     
 49% [=========================                         ] -                     
 54% [============================                      ] \                     
 60% [===============================                   ] |                     
 65% [=================================                 ] /                     
 71% [====================================              ] -                     
 76% [=======================================           ] \                     
 82% [==========================================        ] |                     
 87% [============================================      ] /                     
 93% [===============================================   ] -                     
 98% [==================================================] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/56808ff6-b287-428b-8337-fc4ad445f9fb/final_image/VHL_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.15 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.15 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.15 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.88 MB
Based on canonical annotations, the following gene is in your area of interest: VHL(+)
write fasta - Elapsed time since the previous call: 0.60 seconds
write fasta - Current memory usage: 172.88 MB
Length of region: 91 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 176.52 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/56808ff6-b287-428b-8337-fc4ad445f9fb/fasta/VHL.fasta" "/disk1/www/rails/humanrnamap/public/result/56808ff6-b287-428b-8337-fc4ad445f9fb/ct/VHL.ct" --SHAPE "VHL.dat"

fold - Elapsed time since the previous call: 0.13 seconds
fold - Current memory usage: 176.52 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/56808ff6-b287-428b-8337-fc4ad445f9fb/ct/VHL.ct" "/disk1/www/rails/humanrnamap/public/result/56808ff6-b287-428b-8337-fc4ad445f9fb/fold_FE/VHL.txt" -sh "VHL.dat"

efn2 - Elapsed time since the previous call: 0.44 seconds
efn2 - Current memory usage: 176.52 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/56808ff6-b287-428b-8337-fc4ad445f9fb/ct/VHL.ct" 1 "/disk1/www/rails/humanrnamap/public/result/56808ff6-b287-428b-8337-fc4ad445f9fb/fold_dbn/VHL_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.04 seconds
ct2dot - Current memory usage: 176.52 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CUGUGUUUUUGGUGUUGUCCAAGGAAAAUUAAAAACCUGUAGCAUGAAUAAUGUUUGUUUUUCAUUUCGAAUCUUGUGAAUGUAUUAAAUA', '-structureDBN', '....(((((((((....((....))..))))))))).....((((..((((.(((((..........))))).))))..))))........', '-o', '/disk1/www/rails/humanrnamap/public/result/56808ff6-b287-428b-8337-fc4ad445f9fb/final_image/VHL_fold_1.svg', '-title', 'VHL, -10.8 ± 0.9\n kcal/mol, AUC: 0.63', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,23,24,29,30,38,39,40,42,45,46,49,52,53,54,55,56,57,58,59,60,61,62,65,66,67,69,72,74,75,76,77,78,81,82,83,85,86,90', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '19,87,25,26,31', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '32,33,35,71,44,51,21,91,28', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,68,70,73,79,80,20,84,22,88,89,27,34,36,37,41,43,47,48,50,63']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 338.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 318.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 298.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 278.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 258.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 238.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 218.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 198.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 62.24021242970588, Y: 186.49229011489996, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.648907661438386, Y: 169.6053083013025, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 62.24021769747776, Y: 152.71832791993023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75000908515891, Y: 140.4808709257428, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 91.73393899968947, Y: 136.26229783686534, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 101.8607377848472, Y: 119.01561855171224, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.47740994468609, Y: 102.44141433414927, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 123.87672742455567, Y: 96.33292534005011, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 138.9676026360116, Y: 105.1938923837115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 141.62365216755055, Y: 122.49119426818464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 129.88659162322097, Y: 135.4716665775935, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 119.75979283806322, Y: 152.71834586274662, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.35109233856087, Y: 169.60532217281258, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 119.75978405844651, Y: 186.4922960958384, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 198.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 107.25, Y: 218.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 107.25, Y: 238.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 258.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 278.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 298.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 318.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 338.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.25, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 142.25, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 159.75, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.25, Y: 338.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 318.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 298.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 201.87031668259823, Y: 284.6403117902949, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 201.87031668259823, Y: 267.140308266424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 253.05086904529287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 233.05086904529287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 213.05086904529293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 193.05086904529293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 205.57162284851074, Y: 176.87533261521014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 160.69979618512735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 140.69979618512735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 120.69979618512735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 100.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 80.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 198.9500727174621, Y: 69.32609639184466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.51609813886415, Y: 53.051788915627185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.44301615805517, Y: 35.65822402352319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 204.2831056061255, Y: 21.186812469618417, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 219.75001267560182, Y: 13.000000000000114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 237.24998732439815, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 252.71689439387444, Y: 21.186812469618303, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 262.5569838419448, Y: 35.65822402352319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.48390186113585, Y: 53.05178891562707, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 258.0499272825379, Y: 69.32609639184466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 244.75, Y: 80.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 100.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 120.69979618512735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 140.69979618512735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 160.69979618512735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 251.42837715148926, Y: 176.87533261521014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 193.05086904529293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 213.05086904529293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 233.05086904529287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 253.05086904529287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 255.12968331740177, Y: 267.140308266424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 255.12968331740177, Y: 284.6403117902949, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 298.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 318.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 338.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 358.72975101142595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.25, Y: 358.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.75, Y: 358.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 297.25, Y: 358.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 314.75, Y: 358.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.25, Y: 358.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 358.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 367.25, Y: 358.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 384.75, Y: 358.729751011426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 378.72975101142595, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 51.0, Y: 258.729751011426, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 89.37593349548868, Y: 88.51176524567143, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 123.5, Y: 238.729751011426, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 173.5, Y: 378.72975101142595, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 188.5, Y: 213.05086904529293, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 171.93136939835634, Y: 28.729976708055688, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 261.0, Y: 120.69979618512735, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 260.74856510286514, Y: 301.8911077419923, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 363.5, Y: 378.729751011426, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '91', X: 381.0, Y: 378.729751011426, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'VHL, -10.8 ± 0.9
 kcal/mol, AUC: 0.63', X: 133.25, Y: 391.529751011426, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 5.0, 399.0, 391.529751011426)
Updated viewBox: -0.25 0.0 404.25 396.529751011426
Updated SVG: /disk1/www/rails/humanrnamap/public/result/56808ff6-b287-428b-8337-fc4ad445f9fb/final_image/VHL_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/56808ff6-b287-428b-8337-fc4ad445f9fb/final_image/VHL_fold_final_1.svg
