Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 39% [====================                              ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 56% [=============================                     ] \                     
 62% [================================                  ] |                     
 68% [===================================               ] /                     
 73% [=====================================             ] -                     
 79% [========================================          ] \                     
 85% [===========================================       ] |                     
 90% [==============================================    ] /                     
 96% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/5abb1f8c-cd88-46ba-bd12-e5b63cc43f22/final_image/ZBTB20_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.16 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.16 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.16 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.78 MB
Based on canonical annotations, the following gene is in your area of interest: ZBTB20(-)
write fasta - Elapsed time since the previous call: 0.58 seconds
write fasta - Current memory usage: 172.78 MB
Length of region: 88 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.22 seconds
write dat - Current memory usage: 176.25 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/5abb1f8c-cd88-46ba-bd12-e5b63cc43f22/fasta/ZBTB20.fasta" "/disk1/www/rails/humanrnamap/public/result/5abb1f8c-cd88-46ba-bd12-e5b63cc43f22/ct/ZBTB20.ct" --SHAPE "ZBTB20.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.25 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/5abb1f8c-cd88-46ba-bd12-e5b63cc43f22/ct/ZBTB20.ct" "/disk1/www/rails/humanrnamap/public/result/5abb1f8c-cd88-46ba-bd12-e5b63cc43f22/fold_FE/ZBTB20.txt" -sh "ZBTB20.dat"

efn2 - Elapsed time since the previous call: 0.39 seconds
efn2 - Current memory usage: 176.25 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/5abb1f8c-cd88-46ba-bd12-e5b63cc43f22/ct/ZBTB20.ct" 1 "/disk1/www/rails/humanrnamap/public/result/5abb1f8c-cd88-46ba-bd12-e5b63cc43f22/fold_dbn/ZBTB20_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.25 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAGAUCCAUAAAGUUUUGAAAGUGUCUGUUUUUGCAACCAGAGAUUGCCUAAACAUAAACUUAAUAUAUACUUAAAUAAAAUAAUAAC', '-structureDBN', '......((........)).((((...(((((..((((.......))))..)))))...))))..........................', '-o', '/disk1/www/rails/humanrnamap/public/result/5abb1f8c-cd88-46ba-bd12-e5b63cc43f22/final_image/ZBTB20_fold_1.svg', '-title', 'ZBTB20, -11.8 ± 1.0\n kcal/mol, AUC: 0.832', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,5,9,13,14,15,16,17,18,22,23,24,25,27,28,29,30,31,32,33,34,41,43,45,46,47,50,56,61,62,65,67,69,72,73,77,82,85', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '4,36,6,7,8,37,75,48,52,53', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '35,74,79,49,51,84,21,54,55,59', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,2,66,68,70,71,10,11,12,76,78,80,81,19,20,83,86,87,88,26,38,39,40,42,44,57,58,60,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 353.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 98.09493192571631, Y: 340.75906963002996, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 95.4117893094517, Y: 323.4659711582402, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 102.56324539329538, Y: 307.4938959976642, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 117.24999272779968, Y: 297.978121631557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 134.75000727220032, Y: 297.978121631557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 149.43675460670462, Y: 307.4938959976642, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 156.5882106905483, Y: 323.4659711582402, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 153.9050680742837, Y: 340.75906963002996, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 142.25, Y: 353.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 353.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.25, Y: 333.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 313.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 164.74021374664858, Y: 301.57572516453615, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 160.148907661438, Y: 284.68874630990297, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 164.74021374664858, Y: 267.8017674552697, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.24999999999997, Y: 255.56430880159576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.25, Y: 235.56430880159576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 215.56430880159576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 195.56430880159576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 175.56430880159576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 166.87031668259823, Y: 161.47486958046466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 166.87031668259823, Y: 143.97486605659373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.25, Y: 129.88542683546262, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.25, Y: 109.88542683546257, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 89.88542683546257, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 69.88542683546257, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.79792334355562, Y: 55.849605306378635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.6508797232032, Y: 38.350217585598216, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 176.86561713592343, Y: 24.140737228538796, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 193.5, Y: 18.704976089581123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 210.13438286407657, Y: 24.140737228538796, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 220.3491202767968, Y: 38.350217585598216, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 220.20207665644438, Y: 55.849605306378635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 209.75, Y: 69.88542683546257, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 209.75, Y: 89.88542683546257, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.75, Y: 109.88542683546257, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 209.75, Y: 129.88542683546262, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 220.12968331740177, Y: 143.97486605659373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 220.12968331740177, Y: 161.47486958046466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 175.56430880159576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 195.56430880159576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 215.56430880159576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 209.75, Y: 235.56430880159576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 255.56430880159576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 222.2597862533514, Y: 267.8017674552697, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 226.851092338562, Y: 284.6887463099029, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 222.25978625335142, Y: 301.5757251645361, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 313.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 209.75, Y: 333.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 209.75, Y: 353.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 209.75, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 373.81318381821006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 262.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 297.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 314.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 367.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 384.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 454.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 472.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 489.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 524.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 559.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 577.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 594.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 612.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 629.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 647.25, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 664.75, Y: 373.8131838182101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 393.81318381821006, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 71.83981339315883, Y: 320.8034027039267, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 159.35786437626905, Y: 387.955319441941, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 153.5, Y: 195.56430880159576, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 161.30559589465284, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 235.38026567961225, Y: 167.71809550116117, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 226.0, Y: 333.8131838182101, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 346.0, Y: 393.8131838182101, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 521.0, Y: 393.8131838182101, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '88', X: 661.0, Y: 393.8131838182101, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ZBTB20, -11.8 ± 1.0
 kcal/mol, AUC: 0.832', X: 268.75, Y: 406.61318381821013, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 679.0, 406.61318381821013)
Updated viewBox: -0.25 -5.0 684.25 416.61318381821013
Updated SVG: /disk1/www/rails/humanrnamap/public/result/5abb1f8c-cd88-46ba-bd12-e5b63cc43f22/final_image/ZBTB20_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/5abb1f8c-cd88-46ba-bd12-e5b63cc43f22/final_image/ZBTB20_fold_final_1.svg
