Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  7% [====                                              ] -                     
 14% [========                                          ] \                     
 21% [===========                                       ] |                     
 28% [===============                                   ] /                     
 35% [==================                                ] -                     
 42% [======================                            ] \                     
 50% [==========================                        ] |                     
 57% [=============================                     ] /                     
 64% [=================================                 ] -                     
 71% [====================================              ] \                     
 78% [========================================          ] |                     
 85% [===========================================       ] /                     
 92% [===============================================   ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/5c4c60cc-2207-4fbf-be8f-df2f6d5030e3/final_image/RUNX1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.10 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.10 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.10 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.66 MB
Based on canonical annotations, the following gene is in your area of interest: RUNX1(-)
write fasta - Elapsed time since the previous call: 0.13 seconds
write fasta - Current memory usage: 171.66 MB
Length of region: 70 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.34 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/5c4c60cc-2207-4fbf-be8f-df2f6d5030e3/fasta/RUNX1.fasta" "/disk1/www/rails/humanrnamap/public/result/5c4c60cc-2207-4fbf-be8f-df2f6d5030e3/ct/RUNX1.ct" --SHAPE "RUNX1.dat"

fold - Elapsed time since the previous call: 0.07 seconds
fold - Current memory usage: 175.34 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/5c4c60cc-2207-4fbf-be8f-df2f6d5030e3/ct/RUNX1.ct" "/disk1/www/rails/humanrnamap/public/result/5c4c60cc-2207-4fbf-be8f-df2f6d5030e3/fold_FE/RUNX1.txt" -sh "RUNX1.dat"

efn2 - Elapsed time since the previous call: 0.48 seconds
efn2 - Current memory usage: 175.34 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/5c4c60cc-2207-4fbf-be8f-df2f6d5030e3/ct/RUNX1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/5c4c60cc-2207-4fbf-be8f-df2f6d5030e3/fold_dbn/RUNX1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.34 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CGGCGCACAGCCAUGAGGGUCAGCCCACACCACCCAGCCCCCACGCCCAACCCUCGUGCCUCCCUGAACC', '-structureDBN', '.((..((.((.(((((((((..((....................))...))))))))).))...))..))', '-o', '/disk1/www/rails/humanrnamap/public/result/5c4c60cc-2207-4fbf-be8f-df2f6d5030e3/final_image/RUNX1_fold_1.svg', '-title', 'RUNX1, -15.4 ± 1.0\n kcal/mol, AUC: 0.667', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '65,2,3,66,5,10,14,15,17,18,19,20,23,37,45,54,56,57,58,61', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '51,52,39,63,47', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,67,8,9,12,13,16,24,25,27,32,34,38,40,50,53,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,4,68,6,7,69,70,11,21,22,26,28,29,30,31,33,35,36,41,42,43,44,46,48,49,55,59,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 272.6891327475588, Y: 471.6506037064361, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 290.1891327475588, Y: 471.6506037064361, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 290.1891327475588, Y: 451.6506037064361, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 279.80944943015703, Y: 437.56116448530497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 279.80944943015703, Y: 420.0611609614341, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 290.1891327475588, Y: 405.971721740303, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 290.1891327475588, Y: 385.971721740303, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 279.80944711440554, Y: 371.8822754714298, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.8094540616656, Y: 354.38226489981855, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.94696975359767, Y: 338.2800456105143, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 252.97605656119885, Y: 329.2180834308931, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 248.75875318325475, Y: 312.233921615319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 236.89621244174847, Y: 296.13174390060897, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 225.0336717002422, Y: 280.02956618589894, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 213.1711309587359, Y: 263.9273884711889, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 201.3085902172296, Y: 247.825210756479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 189.44604947572333, Y: 231.72303304176899, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.58350873421705, Y: 215.62085532705896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 165.72096799271074, Y: 199.51867761234894, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 153.85842725120452, Y: 183.41649989763891, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 135.52466984228957, Y: 179.01140322287085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 123.23159123430062, Y: 164.7141392964828, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 121.62437950464366, Y: 145.92721810382727, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.4822438809127, Y: 131.78508248009632, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 91.30253453874175, Y: 138.45342122879117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 73.92059047371768, Y: 140.48264684090293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 56.63994447637041, Y: 137.72058058919174, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 40.75653264077645, Y: 130.3743594840663, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 27.461507583451784, Y: 118.9949023445721, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 17.751909741778526, Y: 104.43559446893983, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 12.355895823782568, Y: 87.78828928577957, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 11.678131789379144, Y: 70.30142644597481, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 15.769445534445744, Y: 53.28640696600053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 24.323015129105706, Y: 38.01924667818707, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 36.69737846756633, Y: 25.644883339726448, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 51.96453875537967, Y: 17.0913137450666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 68.979558235354, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 86.46642107515882, Y: 13.67776403440348, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 103.11372625831896, Y: 19.073777952399382, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 117.67303413395123, Y: 28.78337579407264, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 129.05249127344555, Y: 42.078400851397305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 136.39871237857088, Y: 57.961812686991266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 139.16077863028207, Y: 75.24245868433854, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 137.1315530181703, Y: 92.62440274936273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 130.46321426947551, Y: 108.80411209153351, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.6053498932064, Y: 122.94624771526446, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 161.06590132400177, Y: 123.68505939179772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.76928615507146, Y: 132.83453152251911, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 181.76133602761425, Y: 147.75454608950645, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 180.02446603760825, Y: 164.1398711926912, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 191.88700677911453, Y: 180.24204890740123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 203.7495475206208, Y: 196.34422662211125, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 215.6120882621271, Y: 212.44640433682127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.47462900363337, Y: 228.5485820515313, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 239.33716974513965, Y: 244.6507597662412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 251.19971048664598, Y: 260.75293748095123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 263.06225122815226, Y: 276.85511519566126, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 274.92479196965854, Y: 292.9572929103713, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 289.89578458347205, Y: 302.01926731759295, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 294.11307609871704, Y: 319.003508609904, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 305.97556040678495, Y: 335.1057278992082, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 322.6891418144969, Y: 340.2928462251949, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 333.068818380712, Y: 354.3822860430431, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 333.0688149070841, Y: 371.88228604304277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 322.6891327475588, Y: 385.971721740303, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 322.6891327475588, Y: 405.971721740303, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 333.0688160649606, Y: 420.0611609614341, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 333.0688160649606, Y: 437.56116448530497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 322.6891327475588, Y: 451.6506037064361, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 322.6891327475588, Y: 471.6506037064361, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 273.4391327475588, Y: 491.6506037064361, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 244.44840574728588, Y: 341.44140919109265, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 136.59260734146451, Y: 198.15836586390913, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: -4.0, Y: 113.14944813129034, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 127.19352729164208, Y: 13.82028749814657, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 194.6907947546671, Y: 156.33994577091738, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 299.2359608390023, Y: 301.0794489027502, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 318.9391327475588, Y: 491.6506037064361, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'RUNX1, -15.4 ± 1.0
 kcal/mol, AUC: 0.667', X: 106.37347508504556, Y: 504.4506037064361, Width: 142.5, Height: 23
Calculated bounding box: (-4.0, 5.0, 343.568818380712, 504.4506037064361)
Updated viewBox: -9.0 0.0 357.568818380712 509.4506037064361
Updated SVG: /disk1/www/rails/humanrnamap/public/result/5c4c60cc-2207-4fbf-be8f-df2f6d5030e3/final_image/RUNX1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/5c4c60cc-2207-4fbf-be8f-df2f6d5030e3/final_image/RUNX1_fold_final_1.svg
