Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 36% [===================                               ] \                     
 42% [======================                            ] |                     
 48% [=========================                         ] /                     
 54% [============================                      ] -                     
 60% [===============================                   ] \                     
 67% [==================================                ] |                     
 73% [=====================================             ] /                     
 79% [========================================          ] -                     
 85% [===========================================       ] \                     
 91% [==============================================    ] |                     
 97% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/5c531d7c-d62d-414c-aa3e-3e7acd3d3ce3/final_image/KRAS_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.16 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.16 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.16 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 169.70 MB
Based on canonical annotations, the following gene is in your area of interest: KRAS(-)
write fasta - Elapsed time since the previous call: 0.58 seconds
write fasta - Current memory usage: 169.70 MB
Length of region: 82 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 173.23 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/5c531d7c-d62d-414c-aa3e-3e7acd3d3ce3/fasta/KRAS.fasta" "/disk1/www/rails/humanrnamap/public/result/5c531d7c-d62d-414c-aa3e-3e7acd3d3ce3/ct/KRAS.ct" --SHAPE "KRAS.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 173.23 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/5c531d7c-d62d-414c-aa3e-3e7acd3d3ce3/ct/KRAS.ct" "/disk1/www/rails/humanrnamap/public/result/5c531d7c-d62d-414c-aa3e-3e7acd3d3ce3/fold_FE/KRAS.txt" -sh "KRAS.dat"

efn2 - Elapsed time since the previous call: 0.44 seconds
efn2 - Current memory usage: 173.23 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/5c531d7c-d62d-414c-aa3e-3e7acd3d3ce3/ct/KRAS.ct" 1 "/disk1/www/rails/humanrnamap/public/result/5c531d7c-d62d-414c-aa3e-3e7acd3d3ce3/fold_dbn/KRAS_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.23 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AUGCCUUCUAUACAUUAGUUCGAGAAAUUCGAAAACAUAAAGAAAAGAUGAGCAAAGAUGGUAAAAAGAAGAAAAAGAAGUC', '-structureDBN', '.((((.(((...((((..(((....................)))..)))).....))).))))...................', '-o', '/disk1/www/rails/humanrnamap/public/result/5c531d7c-d62d-414c-aa3e-3e7acd3d3ce3/final_image/KRAS_fold_1.svg', '-title', 'KRAS, -3.8 ± 0.9\n kcal/mol, AUC: 0.458', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,6,7,9,11,15,16,18,19,20,22,24,28,29,31,38,42,47,49,50,52,57,59,60,61,62,68,71,77,80,81', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '33,72,25,74,63', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '32,65,67,4,5,39,40,43,44,45,54,26', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,8,10,12,13,14,17,21,23,27,30,34,35,36,37,41,46,48,51,53,55,56,58,64,66,69,70,73,75,76,78,79,82']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 141.15629963456257, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 158.65629963456257, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 158.65629963456257, Y: 442.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 158.65629963456257, Y: 422.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 158.65629963456257, Y: 402.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 151.9779224830733, Y: 386.1757770445711, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 158.65629963456257, Y: 370.00024061448835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 158.65629963456257, Y: 350.00024061448835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 158.65629963456254, Y: 330.00024061448835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.83321684495002, Y: 319.26839419025407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 137.13767435220137, Y: 303.5512452368297, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 137.13767724114393, Y: 286.05124108020664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.8332249231413, Y: 270.3340946675802, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 136.0383242714047, Y: 252.37164153539132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.24342361966808, Y: 234.40918840320245, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 118.44852296793141, Y: 216.4467352710135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 102.93053071319594, Y: 208.35710221054762, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 95.23499266346226, Y: 192.6399478626348, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 98.36146683562441, Y: 175.42148666769015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.56657331473173, Y: 157.45903004404988, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 80.77167979383904, Y: 139.4965734204095, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 63.30407173521775, Y: 140.56071851148795, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 46.202771399163055, Y: 136.84652103686017, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 30.750265121228438, Y: 128.63252165806387, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 18.105390402777687, Y: 116.53471692252765, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 9.216430632940558, Y: 101.46036352761564, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 84.5399399671486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 5.041051761479196, Y: 67.04236799454009, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 10.067758927634543, Y: 50.27985174159653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 19.453151143771436, Y: 35.50947094035257, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 32.493385015851004, Y: 23.838908116480525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 48.21052778877714, Y: 16.143379601821266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 65.4258959446816, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 82.8484488031711, Y: 14.644502343451109, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 99.17160817823691, Y: 20.953559648681107, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 113.1712432470639, Y: 31.45403363818025, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 123.79747240265789, Y: 45.35845703497296, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 130.2533975482246, Y: 61.62408848841858, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 132.0548662731377, Y: 79.03111139578652, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 129.06678013586185, Y: 96.27411221642967, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 121.51322616868163, Y: 112.0599779997616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 109.96067180725458, Y: 125.2048714489589, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 118.75556532814727, Y: 143.16732807259916, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.55045884903996, Y: 161.12978469623954, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.0684427132657, Y: 169.21941860573315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 150.76397766379117, Y: 184.9365666239088, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 147.63750930773838, Y: 202.15502171194146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 156.43240995947502, Y: 220.11747484413036, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 165.22731061121164, Y: 238.0799279763193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 174.02221126294825, Y: 256.04238110850815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 191.1563073822071, Y: 259.60226174920365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 204.97938511690478, Y: 270.334107906343, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.67492491692374, Y: 286.05125355007624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.67492299096247, Y: 303.55125355007624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 204.97937973144502, Y: 319.26839749994497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 191.15629963456254, Y: 330.00024061448835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 191.15629963456257, Y: 350.00024061448835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 191.15629963456257, Y: 370.00024061448835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.83467678605183, Y: 386.1757770445711, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 191.15629963456257, Y: 402.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 191.15629963456257, Y: 422.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 191.15629963456257, Y: 442.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 191.15629963456257, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 208.65629963456257, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 226.15629963456257, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 243.65629963456257, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 261.1562996345626, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 278.6562996345626, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 296.1562996345626, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 313.6562996345626, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 331.1562996345626, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 348.6562996345626, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 366.1562996345626, Y: 462.3513134746538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 383.6562996345626, Y: 462.35131347465386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 401.1562996345626, Y: 462.35131347465386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 418.6562996345626, Y: 462.35131347465386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 436.1562996345626, Y: 462.35131347465386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 453.6562996345626, Y: 462.35131347465386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 471.1562996345626, Y: 462.35131347465386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 488.6562996345626, Y: 462.35131347465386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 506.15629963456263, Y: 462.35131347465386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 523.6562996345626, Y: 462.35131347465386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 141.90629963456257, Y: 482.3513134746538, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 125.56921257046903, Y: 331.89042538065235, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 67.85411669109143, Y: 166.25392356494262, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 0.4503750821705452, Y: 22.572979050560548, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 144.36987873255424, Y: 102.35518398583991, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 184.2521696904092, Y: 241.73990711389928, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 207.40629963456257, Y: 402.3513134746538, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 309.9062996345626, Y: 482.3513134746538, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 484.9062996345626, Y: 482.35131347465386, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '82', X: 519.9062996345626, Y: 482.35131347465386, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'KRAS, -3.8 ± 0.9
 kcal/mol, AUC: 0.458', X: 198.20314981728131, Y: 495.1513134746539, Width: 142.5, Height: 23
Calculated bounding box: (0.4503750821705452, 5.0, 537.9062996345626, 495.1513134746539)
Updated viewBox: -4.549624917829455 0.0 547.455924552392 500.1513134746539
Updated SVG: /disk1/www/rails/humanrnamap/public/result/5c531d7c-d62d-414c-aa3e-3e7acd3d3ce3/final_image/KRAS_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/5c531d7c-d62d-414c-aa3e-3e7acd3d3ce3/final_image/KRAS_fold_final_1.svg
