Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/5d2347eb-3a03-44cb-92d0-5fc3845d3faa/final_image/KPNB1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.05 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.05 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.05 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.74 MB
Based on canonical annotations, the following gene is in your area of interest: KPNB1(+)
write fasta - Elapsed time since the previous call: 0.60 seconds
write fasta - Current memory usage: 172.74 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.05 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/5d2347eb-3a03-44cb-92d0-5fc3845d3faa/fasta/KPNB1.fasta" "/disk1/www/rails/humanrnamap/public/result/5d2347eb-3a03-44cb-92d0-5fc3845d3faa/ct/KPNB1.ct" --SHAPE "KPNB1.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.05 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/5d2347eb-3a03-44cb-92d0-5fc3845d3faa/ct/KPNB1.ct" "/disk1/www/rails/humanrnamap/public/result/5d2347eb-3a03-44cb-92d0-5fc3845d3faa/fold_FE/KPNB1.txt" -sh "KPNB1.dat"

efn2 - Elapsed time since the previous call: 0.52 seconds
efn2 - Current memory usage: 176.05 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/5d2347eb-3a03-44cb-92d0-5fc3845d3faa/ct/KPNB1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/5d2347eb-3a03-44cb-92d0-5fc3845d3faa/fold_dbn/KPNB1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.05 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAAACGCCCUCUCCUGACUUGUAUUGUGGCAGUCUGAACGCCCCCAGAAAAUUGUGCCAAAGAGUUUAGAAAAAUAAAUAUACAA', '-structureDBN', '.........(((...(((((......(((((.((((........))))......)))))..))))).)))...............', '-o', '/disk1/www/rails/humanrnamap/public/result/5d2347eb-3a03-44cb-92d0-5fc3845d3faa/final_image/KPNB1_fold_1.svg', '-title', 'KPNB1, -8.6 ± 1.4\n kcal/mol, AUC: 0.619', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '6,10,12,15,16,19,20,21,22,24,25,26,27,28,29,32,33,35,36,40,47,52,53,54,55,56,62,64,65,66,67,69,75,79,81', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '49,30,70,7,8,42,14', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,68,72,9,41,11,43,13,76,77,17,57,59', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,3,4,5,71,73,74,78,80,18,82,83,84,85,23,31,34,37,38,39,44,45,46,48,50,51,58,60,61,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 324.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 304.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 151.87031610366017, Y: 290.1062202596845, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 151.87031784047466, Y: 272.6062149738782, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25000453347002, Y: 258.51677605110683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 178.96359459307448, Y: 253.32966776972867, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 190.8260916858514, Y: 237.22745789891096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 202.68858877862831, Y: 221.12524802809324, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.55108587140523, Y: 205.02303815727558, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 226.41358296418215, Y: 188.92082828645792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 221.6433400911286, Y: 171.94210045153196, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 224.88789840255728, Y: 154.6070129892736, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 235.47583962030393, Y: 140.5028321647823, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 251.2161298410224, Y: 132.54823099766136, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 268.85152492131914, Y: 132.38930861958593, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 284.7326139204658, Y: 140.05895190735313, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 295.5730162566675, Y: 153.97002998023012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 315.5730162566675, Y: 153.97002998023012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 335.5730162566675, Y: 153.97002998023012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 355.5730162566675, Y: 153.97002998023012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 375.5730162566675, Y: 153.97002998023012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 387.0166995338157, Y: 140.73003796950613, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 403.34690121699236, Y: 134.43879100419863, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 410.111297110162, Y: 115.61744811373325, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 416.87569300333166, Y: 96.79610522326789, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 423.6400888965013, Y: 77.9747623328027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 417.0870470847855, Y: 61.747989638636454, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 420.4108979386864, Y: 44.56653089511724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 432.5429702757725, Y: 31.954499739829657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 449.58260890431046, Y: 27.9668657968665, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 466.05129762072517, Y: 33.8857171225942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 476.6540897450206, Y: 47.8080484009115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 477.98201811994704, Y: 65.25760757257251, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 469.6081325455726, Y: 80.62408242666686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 454.22477109350746, Y: 88.96690565920335, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 447.4603752003378, Y: 107.78824854966865, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 440.69597930716816, Y: 126.60959144013398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 433.9315834139985, Y: 145.43093433059929, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 442.5207835587328, Y: 160.67808622443502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 442.9181815934081, Y: 178.17357349407214, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 435.0301399864586, Y: 193.79499467164217, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 420.71529084100547, Y: 203.86152803437042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 403.34659280747434, Y: 206.00123096235168, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 387.01657244227937, Y: 199.7099326168338, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 375.5730162566675, Y: 186.47002998023012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 355.5730162566675, Y: 186.47002998023012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 335.5730162566675, Y: 186.47002998023012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 315.5730162566675, Y: 186.47002998023012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 295.5730162566675, Y: 186.47002998023012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 285.09323490455364, Y: 200.08626754766968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 269.75806854347155, Y: 207.83613305353506, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 252.57967400426094, Y: 208.19738606222043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 240.717176911484, Y: 224.2995959330381, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 228.85467981870707, Y: 240.40180580385575, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 216.99218272593015, Y: 256.5040156746735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 205.12968563315323, Y: 272.60622554549116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 205.12968215952534, Y: 290.1062255454908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 304.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 324.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 344.19566124275104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.75, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.25, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.75, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 352.25, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.25, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 422.25, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.25, Y: 344.1956612427511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 364.19566124275104, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 144.35786437626905, Y: 358.337796866482, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 203.52899780762104, Y: 183.10123630021778, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 351.8230162566675, Y: 133.97002998023012, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 446.9833783207983, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 458.67540169185406, Y: 182.58587040506848, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 294.09530060566965, Y: 215.4935651807532, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 205.14213562373095, Y: 358.337796866482, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 366.0, Y: 364.1956612427511, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 453.5, Y: 364.1956612427511, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'KPNB1, -8.6 ± 1.4
 kcal/mol, AUC: 0.619', X: 175.36600905997352, Y: 376.9956612427511, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 488.48201811994704, 376.9956612427511)
Updated viewBox: -0.25 -5.0 493.73201811994704 386.9956612427511
Updated SVG: /disk1/www/rails/humanrnamap/public/result/5d2347eb-3a03-44cb-92d0-5fc3845d3faa/final_image/KPNB1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/5d2347eb-3a03-44cb-92d0-5fc3845d3faa/final_image/KPNB1_fold_final_1.svg
