Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/5df98479-a717-46b2-8511-2f707c5a98f3/final_image/CLASP1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.64 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.64 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.64 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.22 MB
Based on canonical annotations, the following gene is in your area of interest: CLASP1(-)
write fasta - Elapsed time since the previous call: 0.77 seconds
write fasta - Current memory usage: 170.22 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 173.58 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/5df98479-a717-46b2-8511-2f707c5a98f3/fasta/CLASP1.fasta" "/disk1/www/rails/humanrnamap/public/result/5df98479-a717-46b2-8511-2f707c5a98f3/ct/CLASP1.ct" --SHAPE "CLASP1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 173.58 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/5df98479-a717-46b2-8511-2f707c5a98f3/ct/CLASP1.ct" "/disk1/www/rails/humanrnamap/public/result/5df98479-a717-46b2-8511-2f707c5a98f3/fold_FE/CLASP1.txt" -sh "CLASP1.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 173.58 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/5df98479-a717-46b2-8511-2f707c5a98f3/ct/CLASP1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/5df98479-a717-46b2-8511-2f707c5a98f3/fold_dbn/CLASP1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 173.58 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAUAGUCACUGUUUAAGGAAAAAAGUAAUUAUGAGGUGUAGCAGAUUGCAGAAAAACAGGAUUAGAAACACACUUAAAAAGAACA', '-structureDBN', '.....((.((.....))))............((((((((......(((........)))........)))).)))).........', '-o', '/disk1/www/rails/humanrnamap/public/result/5df98479-a717-46b2-8511-2f707c5a98f3/final_image/CLASP1_fold_1.svg', '-title', 'CLASP1, -2.8 ± 0.8\n kcal/mol, AUC: 0.63', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,5,6,10,11,12,13,14,17,18,25,26,29,30,32,33,35,36,37,38,39,41,44,46,47,48,51,59,60,62,63,65,74,75,81', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '16,19,20,76', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '67,68,7,8,78,15,82,52,53,54,85,24,58', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,4,9,21,22,23,27,28,31,34,40,42,43,45,49,50,55,56,57,61,64,66,69,70,71,72,73,77,79,80,83,84']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 294.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 88.43438113341733, Y: 276.94919886402903, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 99.15572209255677, Y: 263.11788953102666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 107.66734010780456, Y: 245.01948190045016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 108.54059670484926, Y: 227.54126028744315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 121.50287514334653, Y: 215.78412859980202, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 138.98315313849795, Y: 216.61520564189328, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 150.7715301027102, Y: 229.54907499283763, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 149.98263745505636, Y: 247.03130757989996, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 137.07725250749135, Y: 258.8508611752278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 128.56563449224356, Y: 276.9492688058043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 294.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 229.75, Y: 314.028230525464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 247.25, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.75, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 299.75, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.25, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 352.25, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 294.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 274.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 254.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 348.43439675932206, Y: 236.9491289223082, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 339.92290491375286, Y: 218.85066195510876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 331.41141306818366, Y: 200.75219498790932, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 322.89992122261447, Y: 182.65372802070988, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 305.61828265139457, Y: 182.3775943928781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 289.2675063137598, Y: 176.775505974856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 275.4475946573278, Y: 166.3956541794252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 265.51089279523256, Y: 152.253757644995, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 260.42975500425587, Y: 135.73366926037056, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 260.7013951618533, Y: 118.45195947483501, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 266.29923196643693, Y: 102.09972707078873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 252.15709634270593, Y: 87.95759144705778, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 238.01496071897498, Y: 73.81545582332683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 220.54293038361243, Y: 72.82618082899796, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 206.41759484763188, Y: 62.49538197072002, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 200.180475284211, Y: 46.14457622281179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 203.8369053354969, Y: 29.030809006494906, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 216.2112842907058, Y: 16.656430051285952, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 233.3250515070228, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.67585725493097, Y: 19.237119563420947, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 260.0066561132089, Y: 33.36245509940147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 260.9959311075378, Y: 50.83448543476402, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 275.13806673126874, Y: 64.97662105849497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 289.2802023549997, Y: 79.11875668222592, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 306.01602249505737, Y: 73.45537090061873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 323.6838839241433, Y: 73.36433906944819, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 340.4771739810609, Y: 78.85496957385323, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 354.6787085820573, Y: 89.3658225006318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 364.8363214691188, Y: 103.82211921549873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 369.9113542781329, Y: 120.74564296970254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.3848636969418, Y: 138.40589273972523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 363.31068558755976, Y: 154.99703418831677, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.30993004431355, Y: 168.82255377165995, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 360.82142188988274, Y: 186.9210207388594, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.33291373545194, Y: 205.01948770605884, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 377.84440558102114, Y: 223.11795467325828, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 388.5656344922436, Y: 236.94926880580434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 384.75, Y: 254.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 384.75, Y: 274.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 384.75, Y: 294.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 384.75, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 402.25, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 454.75, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 472.25, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 489.75, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 524.75, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 314.02823052546404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 334.028230525464, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 89.5662477634515, Y: 231.08943708631367, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 138.5, Y: 334.028230525464, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 313.5, Y: 334.02823052546404, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 298.4249108322178, Y: 202.07894435969254, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 186.7686210512863, Y: 74.6289153482287, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 298.9666232859407, Y: 53.72939906501881, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 383.6813807026514, Y: 196.50799586048964, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 451.0, Y: 334.02823052546404, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 538.5, Y: 334.02823052546404, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLASP1, -2.8 ± 0.8
 kcal/mol, AUC: 0.63', X: 212.0, Y: 346.82823052546405, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 5.0, 556.5, 346.82823052546405)
Updated viewBox: -0.25 0.0 561.75 351.82823052546405
Updated SVG: /disk1/www/rails/humanrnamap/public/result/5df98479-a717-46b2-8511-2f707c5a98f3/final_image/CLASP1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/5df98479-a717-46b2-8511-2f707c5a98f3/final_image/CLASP1_fold_final_1.svg
