Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 20% [===========                                       ] /                     
 25% [=============                                     ] -                     
 30% [================                                  ] \                     
 35% [==================                                ] |                     
 40% [=====================                             ] /                     
 45% [=======================                           ] -                     
 50% [==========================                        ] \                     
 55% [============================                      ] |                     
 60% [===============================                   ] /                     
 65% [=================================                 ] -                     
 70% [====================================              ] \                     
 75% [======================================            ] |                     
 80% [=========================================         ] /                     
 85% [===========================================       ] -                     
 90% [==============================================    ] \                     
 95% [================================================  ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/5e19a103-3085-49fd-9ee8-c5858001d9c0/final_image/DNAJC13_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.85 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.85 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.85 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.44 MB
Based on canonical annotations, the following gene is in your area of interest: DNAJC13(+)
write fasta - Elapsed time since the previous call: 1.18 seconds
write fasta - Current memory usage: 172.44 MB
Length of region: 99 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.21 seconds
write dat - Current memory usage: 176.14 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/5e19a103-3085-49fd-9ee8-c5858001d9c0/fasta/DNAJC13.fasta" "/disk1/www/rails/humanrnamap/public/result/5e19a103-3085-49fd-9ee8-c5858001d9c0/ct/DNAJC13.ct" --SHAPE "DNAJC13.dat"

fold - Elapsed time since the previous call: 0.14 seconds
fold - Current memory usage: 176.14 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/5e19a103-3085-49fd-9ee8-c5858001d9c0/ct/DNAJC13.ct" "/disk1/www/rails/humanrnamap/public/result/5e19a103-3085-49fd-9ee8-c5858001d9c0/fold_FE/DNAJC13.txt" -sh "DNAJC13.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 176.14 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/5e19a103-3085-49fd-9ee8-c5858001d9c0/ct/DNAJC13.ct" 1 "/disk1/www/rails/humanrnamap/public/result/5e19a103-3085-49fd-9ee8-c5858001d9c0/fold_dbn/DNAJC13_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.14 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAAGCUCAGAUCUCGUACCUGAGAAGGAUGCUGAUCGGAUGCAUGUUAGAGACAAUGUGAAAAUAGCAAUGGAUCAGUAUGGAAAAUUUAAUAAAGUUC', '-structureDBN', '....(((((.........)))))....(((((((((...(((.......................)))...)))))))))...................', '-o', '/disk1/www/rails/humanrnamap/public/result/5e19a103-3085-49fd-9ee8-c5858001d9c0/final_image/DNAJC13_fold_1.svg', '-title', 'DNAJC13, -21.4 ± 0.7\n kcal/mol, AUC: 0.835', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,6,9,11,13,15,16,20,21,23,26,27,29,30,32,33,35,37,38,40,41,44,45,46,47,49,51,56,57,58,59,64,66,70,71,72,74,77,78,80,81,82,87,88,89,92,96,97,98', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '5,7,8,75,76,17,19,83,28,31', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '34,67,68,99,39,73,10,42,12,18,84,22,90,61', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,3,65,69,14,79,85,86,24,25,91,93,94,95,36,43,48,50,52,53,54,55,60,62,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 393.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 373.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 353.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 333.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 62.17225050021045, Y: 321.6831513792182, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.42539153751602, Y: 304.83925616224076, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 61.798879749250176, Y: 287.8945792118221, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.1046824916709, Y: 275.45204349932123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 91.0, Y: 270.89159150582594, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 107.8953175083291, Y: 275.45204349932123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 120.20112025074985, Y: 287.8945792118221, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.57460846248398, Y: 304.83925616224076, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 119.82774949978955, Y: 321.68315137921815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.25, Y: 333.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 107.25, Y: 353.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 107.25, Y: 373.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 393.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 107.25, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 159.75, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.25, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 393.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 373.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 353.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 333.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 313.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 293.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 273.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 253.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 182.24021374664858, Y: 241.61326000963066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.648907661438, Y: 224.72628115499748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 182.24021374664858, Y: 207.8393023003643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.74999999999997, Y: 195.60184364669033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 175.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 155.6018436466902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.30125329546638, Y: 149.62789695973834, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 163.77210124548367, Y: 139.8732545840827, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 152.015484265852, Y: 126.91056719439825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 143.7215798521686, Y: 111.5008151929826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 139.37728539905606, Y: 94.54863501245404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 139.23763466928662, Y: 77.04921202647745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 143.31082592185746, Y: 60.02985774411911, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 151.35774062950367, Y: 44.48970102495059, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.90598103955276, Y: 31.341033769287037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.2776024967888, Y: 21.355754411233875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 193.62891248981924, Y: 15.120053273408644, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 211.0, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 228.37108751018087, Y: 15.120053273408644, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.7223975032112, Y: 21.355754411233875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 259.0940189604473, Y: 31.341033769287037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 270.6422593704964, Y: 44.48970102495059, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 278.6891740781425, Y: 60.029857744119, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.7623653307134, Y: 77.04921202647756, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.62271460094394, Y: 94.54863501245404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 278.2784201478314, Y: 111.50081519298271, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 269.984515734148, Y: 126.91056719439825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 258.22789875451633, Y: 139.87325458408282, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 243.69874670453362, Y: 149.62789695973834, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.25, Y: 155.6018436466902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.25, Y: 175.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 195.60184364669027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 239.75978625335142, Y: 207.8393023003643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.351092338562, Y: 224.72628115499748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 239.75978625335142, Y: 241.61326000963066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.25, Y: 253.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 273.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 293.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.25, Y: 313.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 333.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.25, Y: 353.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 373.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 393.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 413.85071866330463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.25, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.75, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 297.25, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 314.75, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.25, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.75, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 367.25, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 384.75, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 402.25, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.25, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 454.75, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.25, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 489.75, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 524.75, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 542.25, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 559.75, Y: 413.8507186633047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 433.85071866330463, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 41.25094697971625, Y: 331.9372400957772, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 123.5, Y: 353.8507186633047, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 171.0, Y: 373.8507186633047, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 171.70060020780983, Y: 190.35463794639503, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 131.09246836573885, Y: 33.209373811003275, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 298.8837621261669, Y: 74.78479391189722, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 260.601092338562, Y: 224.72628115499748, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 237.64213562373095, Y: 427.9928542870356, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 398.5, Y: 433.8507186633047, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '99', X: 556.0, Y: 433.8507186633047, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'DNAJC13, -21.4 ± 0.7
 kcal/mol, AUC: 0.835', X: 214.0, Y: 446.6507186633047, Width: 147.0, Height: 23
Calculated bounding box: (4.75, 5.0, 574.0, 446.6507186633047)
Updated viewBox: -0.25 0.0 579.25 451.6507186633047
Updated SVG: /disk1/www/rails/humanrnamap/public/result/5e19a103-3085-49fd-9ee8-c5858001d9c0/final_image/DNAJC13_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/5e19a103-3085-49fd-9ee8-c5858001d9c0/final_image/DNAJC13_fold_final_1.svg
