Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 36% [===================                               ] \                     
 42% [======================                            ] |                     
 48% [=========================                         ] /                     
 54% [============================                      ] -                     
 60% [===============================                   ] \                     
 66% [==================================                ] |                     
 72% [=====================================             ] /                     
 78% [========================================          ] -                     
 84% [===========================================       ] \                     
 90% [==============================================    ] |                     
 96% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/610ae16b-8cb5-498c-9963-ddeeed0b9f4a/final_image/SAMD4A_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.48 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.48 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.48 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.05 MB
Based on canonical annotations, the following gene is in your area of interest: SAMD4A(+)
write fasta - Elapsed time since the previous call: 0.49 seconds
write fasta - Current memory usage: 170.05 MB
Length of region: 83 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 173.02 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/610ae16b-8cb5-498c-9963-ddeeed0b9f4a/fasta/SAMD4A.fasta" "/disk1/www/rails/humanrnamap/public/result/610ae16b-8cb5-498c-9963-ddeeed0b9f4a/ct/SAMD4A.ct" --SHAPE "SAMD4A.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 173.02 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/610ae16b-8cb5-498c-9963-ddeeed0b9f4a/ct/SAMD4A.ct" "/disk1/www/rails/humanrnamap/public/result/610ae16b-8cb5-498c-9963-ddeeed0b9f4a/fold_FE/SAMD4A.txt" -sh "SAMD4A.dat"

efn2 - Elapsed time since the previous call: 0.51 seconds
efn2 - Current memory usage: 173.02 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/610ae16b-8cb5-498c-9963-ddeeed0b9f4a/ct/SAMD4A.ct" 1 "/disk1/www/rails/humanrnamap/public/result/610ae16b-8cb5-498c-9963-ddeeed0b9f4a/fold_dbn/SAMD4A_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.02 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAUUGACCCCCACCAAAUGCAACUGUUUUAUAUUAAGAAAAUAGUAACAAUUUUAAAAUCUCAGAGUAAAAUCUAUUUCACUA', '-structureDBN', '..................(..((((((((........))))))))..).((((((...........))))))...........', '-o', '/disk1/www/rails/humanrnamap/public/result/610ae16b-8cb5-498c-9963-ddeeed0b9f4a/final_image/SAMD4A_fold_1.svg', '-title', 'SAMD4A, -4.9 ± 0.9\n kcal/mol, AUC: 0.595', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,5,18,19,24,25,26,27,28,29,31,33,34,37,42,44,45,51,52,53,54,59,61,64,66,67,72,74,76,77,78,82', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '69,6,8,17,49,20,21,22,23,55', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '35,68,70,39,9,10,43,14,15,56,30', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,65,7,71,73,11,12,13,75,79,16,80,81,83,32,36,38,40,41,46,47,48,50,57,58,60,62,63']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 254.51394415278622, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 254.51394415278622, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 254.51394415278622, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 254.51394415278622, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 254.51394415278622, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 254.51394415278622, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 254.51394415278622, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.25, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.75, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 319.75, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 309.37031668259823, Y: 240.42450493165518, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 309.37031668259823, Y: 222.92450140778422, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 208.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 188.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.75, Y: 168.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 319.75, Y: 148.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.75, Y: 128.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.75, Y: 108.83506218665318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.75, Y: 88.83506218665318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.75, Y: 68.83506218665318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 308.0949319257163, Y: 55.78094799847307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 305.4117893094517, Y: 38.48784952668328, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 312.56324539329535, Y: 22.51577436610728, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 327.2499927277997, Y: 13.000000000000114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 344.7500072722003, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 359.43675460670465, Y: 22.51577436610728, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 366.5882106905483, Y: 38.48784952668328, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 363.9050680742837, Y: 55.78094799847307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 68.83506218665318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 88.83506218665318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 108.83506218665318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 128.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 352.25, Y: 148.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 168.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 188.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 352.25, Y: 208.83506218665315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 362.62968331740177, Y: 222.92450140778422, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 362.62968331740177, Y: 240.42450493165518, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 254.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 387.25, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.25, Y: 234.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.25, Y: 214.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.25, Y: 194.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.25, Y: 174.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 387.25, Y: 154.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 373.37477833807435, Y: 143.84964120873258, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 365.55163083993995, Y: 128.1956482142102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 365.35220631815395, Y: 110.69680930100705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 372.8165686105687, Y: 94.86859307119457, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 386.4451478655141, Y: 83.89084462527936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 403.5, Y: 79.96896342859017, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 420.5548521344859, Y: 83.89084462527936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 434.1834313894313, Y: 94.86859307119462, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 441.64779368184605, Y: 110.69680930100705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 441.44836916006005, Y: 128.19564821421022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 433.62522166192565, Y: 143.84964120873258, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 419.75, Y: 154.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 174.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 194.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 214.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 234.51394415278625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 419.75, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 437.25, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 454.75, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.25, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 489.75, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 507.25, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 524.75, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 542.25, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 559.75, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 577.25, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 594.75, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 612.25, Y: 254.51394415278628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 274.5139441527862, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 274.5139441527863, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 286.61973432038775, Y: 246.66773085235167, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 286.26170394919785, Y: 64.32476833537501, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 368.5, Y: 108.83506218665318, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 369.35786437626905, Y: 268.65607977651723, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 373.9588483507992, Y: 65.89981711740222, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 436.0, Y: 214.51394415278628, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 556.0, Y: 274.5139441527863, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '83', X: 608.5, Y: 274.5139441527863, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'SAMD4A, -4.9 ± 0.9
 kcal/mol, AUC: 0.595', X: 242.5, Y: 287.3139441527863, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 626.5, 287.3139441527863)
Updated viewBox: -0.25 0.0 631.75 292.3139441527863
Updated SVG: /disk1/www/rails/humanrnamap/public/result/610ae16b-8cb5-498c-9963-ddeeed0b9f4a/final_image/SAMD4A_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/610ae16b-8cb5-498c-9963-ddeeed0b9f4a/final_image/SAMD4A_fold_final_1.svg
