Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 20% [===========                                       ] /                     
 26% [==============                                    ] -                     
 31% [================                                  ] \                     
 36% [===================                               ] |                     
 41% [=====================                             ] /                     
 46% [========================                          ] -                     
 52% [===========================                       ] \                     
 57% [=============================                     ] |                     
 62% [================================                  ] /                     
 67% [==================================                ] -                     
 72% [=====================================             ] \                     
 78% [========================================          ] |                     
 83% [==========================================        ] /                     
 88% [=============================================     ] -                     
 93% [===============================================   ] \                     
 98% [==================================================] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/6298c9f1-bc33-40f6-8baa-e6eb765fbcba/final_image/KRAS_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.54 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.54 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.54 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.01 MB
Based on canonical annotations, the following gene is in your area of interest: KRAS(-)
write fasta - Elapsed time since the previous call: 0.55 seconds
write fasta - Current memory usage: 170.01 MB
Length of region: 96 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 173.33 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/6298c9f1-bc33-40f6-8baa-e6eb765fbcba/fasta/KRAS.fasta" "/disk1/www/rails/humanrnamap/public/result/6298c9f1-bc33-40f6-8baa-e6eb765fbcba/ct/KRAS.ct" --SHAPE "KRAS.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 173.33 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/6298c9f1-bc33-40f6-8baa-e6eb765fbcba/ct/KRAS.ct" "/disk1/www/rails/humanrnamap/public/result/6298c9f1-bc33-40f6-8baa-e6eb765fbcba/fold_FE/KRAS.txt" -sh "KRAS.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 173.33 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/6298c9f1-bc33-40f6-8baa-e6eb765fbcba/ct/KRAS.ct" 1 "/disk1/www/rails/humanrnamap/public/result/6298c9f1-bc33-40f6-8baa-e6eb765fbcba/fold_dbn/KRAS_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 173.33 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGUUUUAAUACUUGUAAUUCCCCUAACCAUAAGAUUUACUGCUGCUGUGGAUAUCUCCAUGAAGUUUUCCCACUGAGUCACAUCAGAAAUGCCCUA', '-structureDBN', '.............((((.((............)).)))).(((..((((((....)))))).))).......((((......))))..........', '-o', '/disk1/www/rails/humanrnamap/public/result/6298c9f1-bc33-40f6-8baa-e6eb765fbcba/final_image/KRAS_fold_1.svg', '-title', 'KRAS, -13.0 ± 0.8\n kcal/mol, AUC: 0.546', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,5,6,9,12,13,14,15,18,19,24,30,33,35,36,37,40,41,43,44,46,47,48,49,50,52,54,56,60,61,64,65,66,67,68,74,75,77,78,83,86,90,91,95', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '70,42,45,79,51,84,21,23,89,58,59,92,93', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,69,71,10,80,82,20,85,22,25,28,29,94,31,32,38,39,57,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '7,8,72,73,11,76,16,17,81,87,88,26,27,96,34,53,55,62']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 232.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.25, Y: 196.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 176.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 156.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 225.57162284851074, Y: 140.51479572559464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.25, Y: 124.33925929551191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 104.33925929551191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 217.90937677557255, Y: 94.30951989974068, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 208.9330543069434, Y: 79.28704401354742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 206.89509968812027, Y: 61.90613817456159, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.15288391549737, Y: 45.21467772826094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 223.78441413859161, Y: 32.13963847473218, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 239.75001218840742, Y: 24.97382897937223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 257.2499878115925, Y: 24.973828979372172, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 273.2155858614084, Y: 32.13963847473218, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.84711608450266, Y: 45.214677728260995, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 290.10490031187976, Y: 61.906138174561534, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 288.0669456930566, Y: 79.28704401354736, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.0906232244275, Y: 94.30951989974062, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 264.75, Y: 104.33925929551191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.75, Y: 124.33925929551188, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 271.42837715148926, Y: 140.51479572559464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.75, Y: 156.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.75, Y: 176.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.75, Y: 196.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 299.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 196.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 299.75, Y: 176.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 290.95286497225464, Y: 161.5622556979138, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 294.00956638777143, Y: 144.33132831530597, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 307.4734861564859, Y: 133.15227887137084, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 314.35284558024284, Y: 114.37265124144255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 321.2322050039998, Y: 95.59302361151424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 328.1115644277568, Y: 76.81339598158598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.99092385151374, Y: 58.03376835165767, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 341.8702832752707, Y: 39.254140721729414, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 344.43247586346126, Y: 21.942687266354596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 359.4750685938641, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 375.90727634789965, Y: 19.019451796035867, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 381.61376179708196, Y: 35.56294826488602, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 372.3871781739042, Y: 50.43309978533449, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 365.50781875014724, Y: 69.21272741526275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 358.62845932639027, Y: 87.99235504519106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 351.7490999026333, Y: 106.77198267511932, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 344.86974047887634, Y: 125.55161030504763, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 337.9903810551193, Y: 144.33123793497592, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 341.04714415869086, Y: 161.56220422618094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.25, Y: 176.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 196.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 367.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 384.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 419.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 437.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 454.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 472.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 472.25, Y: 196.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 472.25, Y: 176.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.25, Y: 156.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 463.40309990849715, Y: 141.59127554309265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 466.36830502339313, Y: 124.34434217957357, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 479.7500121168788, Y: 113.06697249142258, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 497.2499878831212, Y: 113.06697249142258, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 510.6316949766069, Y: 124.34434217957357, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 513.5969000915029, Y: 141.59127554309268, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 504.75, Y: 156.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 504.75, Y: 176.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 504.75, Y: 196.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 504.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 522.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 539.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 557.25, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 574.75, Y: 216.69033215567742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 592.25, Y: 216.69033215567745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 609.75, Y: 216.69033215567745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 627.25, Y: 216.69033215567745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 644.75, Y: 216.69033215567745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 662.25, Y: 216.69033215567745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 679.75, Y: 216.69033215567745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 236.69033215567742, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 236.69033215567742, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 208.50281624090792, Y: 104.00363792386867, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 306.26619200839866, Y: 60.024526371841176, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 278.5, Y: 236.69033215567742, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 312.4612962215855, Y: 51.154408927900676, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 359.89936810880465, Y: 132.43096972880463, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 416.0, Y: 236.69033215567742, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 500.36045381955614, Y: 94.28043456835073, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 571.0, Y: 236.69033215567742, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '96', X: 676.0, Y: 236.69033215567745, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'KRAS, -13.0 ± 0.8
 kcal/mol, AUC: 0.546', X: 276.25, Y: 249.49033215567746, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 694.0, 249.49033215567746)
Updated viewBox: -0.25 0.0 699.25 254.49033215567746
Updated SVG: /disk1/www/rails/humanrnamap/public/result/6298c9f1-bc33-40f6-8baa-e6eb765fbcba/final_image/KRAS_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/6298c9f1-bc33-40f6-8baa-e6eb765fbcba/final_image/KRAS_fold_final_1.svg
