Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  7% [====                                              ] -                     
 14% [========                                          ] \                     
 21% [===========                                       ] |                     
 28% [===============                                   ] /                     
 35% [==================                                ] -                     
 42% [======================                            ] \                     
 49% [=========================                         ] |                     
 56% [=============================                     ] /                     
 63% [================================                  ] -                     
 70% [====================================              ] \                     
 77% [=======================================           ] |                     
 84% [===========================================       ] /                     
 91% [==============================================    ] -                     
 98% [==================================================] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/63850425-053a-4920-a797-78c68403dd46/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.43 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.43 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.43 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 173.09 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.33 seconds
write fasta - Current memory usage: 173.09 MB
Length of region: 71 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 176.37 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/63850425-053a-4920-a797-78c68403dd46/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/63850425-053a-4920-a797-78c68403dd46/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 176.37 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/63850425-053a-4920-a797-78c68403dd46/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/63850425-053a-4920-a797-78c68403dd46/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.40 seconds
efn2 - Current memory usage: 176.37 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/63850425-053a-4920-a797-78c68403dd46/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/63850425-053a-4920-a797-78c68403dd46/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.37 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGCACCUUCCCUCAGUCACAUCACCAGCAACAUCAGUCUCAGCAACAGCAGCAACUCAGCCGGCACAGGAC', '-structureDBN', '.........(((..(((........................((....)).((......)).)))..)))..', '-o', '/disk1/www/rails/humanrnamap/public/result/63850425-053a-4920-a797-78c68403dd46/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -2.0 ± 0.8\n kcal/mol, AUC: 0.534', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,68,69,7,8,12,15,16,21,27,33,36,37,39,42,48,51,56,59,62,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '32,34,70,71', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,4,6,9,10,11,18,22,25,26,28,31,35,41,45,50,52,53,54,57,58,60,61', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,65,66,3,67,5,13,14,17,19,20,23,24,29,30,38,40,43,44,46,47,49,55']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 310.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 290.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 151.87031668259823, Y: 276.1590118258133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 151.87031668259823, Y: 258.6590083019424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.25, Y: 244.56956908081133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 224.56956908081133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 204.56956908081133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 145.9452704276992, Y: 200.28930795968307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 130.63448768377168, Y: 193.2363104792388, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 116.78511392035853, Y: 183.62591568754652, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 104.81999218693208, Y: 171.75154397384352, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 95.10443637042331, Y: 157.97573848497274, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 87.93507759068994, Y: 142.7190961158811, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 83.53080758832417, Y: 126.4474260283589, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 82.026095617338, Y: 109.6575277685339, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 83.46688288845034, Y: 92.86202319944448, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 87.80917991204484, Y: 76.57370535352243, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 94.92040956611314, Y: 61.28988205900606, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 104.58345488321747, Y: 47.47719235386563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 116.50328797120369, Y: 35.55735926587943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 130.3159776763441, Y: 25.894313948775107, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 145.5998009708605, Y: 18.783084294706782, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 161.88811881678254, Y: 14.440787271112299, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 178.68362338587198, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 195.47352164569696, Y: 14.504711970986193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 211.74519173321906, Y: 18.908981973351956, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.0018341023108, Y: 26.078340753085342, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 240.77763959118158, Y: 35.79389656959415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 252.65201130488458, Y: 47.759018303020525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.2624060965768, Y: 61.60839206643374, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 269.3154035770211, Y: 76.9191748103612, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 273.59566469814933, Y: 93.223904382662, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 293.59566469814933, Y: 93.223904382662, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.7321093657405, Y: 89.67516999542289, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 324.3032963122743, Y: 100.72388650272899, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 324.3032963122743, Y: 118.22392226259501, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.73210936574054, Y: 129.2726387699011, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 293.59566469814933, Y: 125.723904382662, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 273.59566469814933, Y: 125.723904382662, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.630427128003, Y: 146.39293611918765, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 257.233274563785, Y: 165.2262085578842, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 271.37541018751597, Y: 179.3683441816151, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 288.30775855497575, Y: 183.78928645471183, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 298.40646544664065, Y: 198.08142663508062, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 296.918474197424, Y: 215.5180270451757, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.54412266251376, Y: 227.89237858008596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.1075222524187, Y: 229.3803698293026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 252.81538207204989, Y: 219.2816629376377, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 248.39443979895316, Y: 202.3493145701779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 234.2523041752222, Y: 188.20717894644696, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 215.41903173652565, Y: 198.60433151066502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 204.56956908081133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 224.56956908081133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 244.56956908081133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 205.12968331740177, Y: 258.6590083019424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 205.12968331740177, Y: 276.1590118258133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 290.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 310.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 330.2484510469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 350.2484510469444, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 144.35786437626905, Y: 344.39058667067536, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 100.24102733568135, Y: 198.99833737262216, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 99.90077616978638, Y: 20.233751975347957, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 275.87715460729333, Y: 51.68541322137071, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 282.35801777822877, Y: 154.04660476648945, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 226.60049773489942, Y: 207.82288455451152, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 208.5, Y: 350.2484510469444, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '71', X: 226.0, Y: 350.2484510469444, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -2.0 ± 0.8
 kcal/mol, AUC: 0.534', X: 98.52664815613716, Y: 363.0484510469444, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 334.8032963122743, 363.0484510469444)
Updated viewBox: -0.25 0.0 340.0532963122743 368.0484510469444
Updated SVG: /disk1/www/rails/humanrnamap/public/result/63850425-053a-4920-a797-78c68403dd46/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/63850425-053a-4920-a797-78c68403dd46/final_image/CLOCK_fold_final_1.svg
