Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  9% [=====                                             ] -                     
 19% [==========                                        ] \                     
 29% [===============                                   ] |                     
 39% [====================                              ] /                     
 49% [=========================                         ] -                     
 58% [==============================                    ] \                     
 68% [===================================               ] |                     
 78% [========================================          ] /                     
 88% [=============================================     ] -                     
 98% [==================================================] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/676d5f78-4639-4855-a214-00ebd9351286/final_image/ATP13A3_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.25 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.25 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.25 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.85 MB
Based on canonical annotations, the following gene is in your area of interest: ATP13A3(-)
write fasta - Elapsed time since the previous call: 0.59 seconds
write fasta - Current memory usage: 171.85 MB
Length of region: 51 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.16 seconds
write dat - Current memory usage: 175.10 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/676d5f78-4639-4855-a214-00ebd9351286/fasta/ATP13A3.fasta" "/disk1/www/rails/humanrnamap/public/result/676d5f78-4639-4855-a214-00ebd9351286/ct/ATP13A3.ct" --SHAPE "ATP13A3.dat"

fold - Elapsed time since the previous call: 0.07 seconds
fold - Current memory usage: 175.10 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/676d5f78-4639-4855-a214-00ebd9351286/ct/ATP13A3.ct" "/disk1/www/rails/humanrnamap/public/result/676d5f78-4639-4855-a214-00ebd9351286/fold_FE/ATP13A3.txt" -sh "ATP13A3.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 175.10 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/676d5f78-4639-4855-a214-00ebd9351286/ct/ATP13A3.ct" 1 "/disk1/www/rails/humanrnamap/public/result/676d5f78-4639-4855-a214-00ebd9351286/fold_dbn/ATP13A3_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.10 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAUGGUACCCUCUUGUCAAAAAGGCAUACAUUCAUAAUUGUACAUUCAGCA', '-structureDBN', '..............(((.....))).((((........)))).........', '-o', '/disk1/www/rails/humanrnamap/public/result/676d5f78-4639-4855-a214-00ebd9351286/final_image/ATP13A3_fold_1.svg', '-title', 'ATP13A3, -4.7 ± 0.6\n kcal/mol, AUC: 0.783', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,5,6,11,13,14,15,16,23,24,27,31,32,35,38,39,40,41,45,46,49', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '9,18,29', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '48,36,25,42,28,30,47', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,7,8,10,12,17,19,20,21,22,26,33,34,37,43,44,50,51']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.25, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.25, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 249.75, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 249.75, Y: 88.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 243.1018303951821, Y: 72.64702188699852, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.82804965122153, Y: 56.49125566074508, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 266.0, Y: 49.80404176000064, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.17195034877847, Y: 56.49125566074508, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 288.8981696048179, Y: 72.64702188699852, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 282.25, Y: 88.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 282.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 282.25, Y: 128.8350621866531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.75, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.25, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.25, Y: 88.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 68.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 305.5949319257163, Y: 55.78094799847298, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.9117893094517, Y: 38.48784952668322, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 310.0632453932954, Y: 22.515774366107223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 324.7499927277997, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 342.2500072722003, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 356.93675460670465, Y: 22.515774366107223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 364.0882106905483, Y: 38.48784952668322, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 361.4050680742837, Y: 55.78094799847298, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.75, Y: 68.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 349.75, Y: 88.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.75, Y: 108.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 367.25, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 384.75, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 419.75, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 437.25, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 454.75, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 472.25, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 489.75, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 128.83506218665312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 148.8350621866531, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 148.8350621866531, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 262.25, Y: 29.804041760000644, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 293.98507546094055, Y: 73.21315768981607, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 366.0, Y: 88.83506218665312, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 486.0, Y: 148.83506218665312, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '51', X: 503.5, Y: 148.83506218665312, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ATP13A3, -4.7 ± 0.6
 kcal/mol, AUC: 0.783', X: 190.0, Y: 161.63506218665313, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 521.5, 161.63506218665313)
Updated viewBox: -0.25 0.0 526.75 166.63506218665313
Updated SVG: /disk1/www/rails/humanrnamap/public/result/676d5f78-4639-4855-a214-00ebd9351286/final_image/ATP13A3_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/676d5f78-4639-4855-a214-00ebd9351286/final_image/ATP13A3_fold_final_1.svg
