Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 19% [==========                                        ] |                     
 25% [=============                                     ] /                     
 32% [=================                                 ] -                     
 38% [====================                              ] \                     
 44% [=======================                           ] |                     
 51% [==========================                        ] /                     
 57% [=============================                     ] -                     
 64% [=================================                 ] \                     
 70% [====================================              ] |                     
 76% [=======================================           ] /                     
 83% [==========================================        ] -                     
 89% [=============================================     ] \                     
 96% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/68ef5cbc-c363-45ed-b967-2d07ff6250ba/final_image/PLEKHM2_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.93 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.93 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.93 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.58 MB
Based on canonical annotations, the following gene is in your area of interest: PLEKHM2(+)
write fasta - Elapsed time since the previous call: 1.97 seconds
write fasta - Current memory usage: 172.58 MB
Length of region: 78 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 175.59 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/68ef5cbc-c363-45ed-b967-2d07ff6250ba/fasta/PLEKHM2.fasta" "/disk1/www/rails/humanrnamap/public/result/68ef5cbc-c363-45ed-b967-2d07ff6250ba/ct/PLEKHM2.ct" --SHAPE "PLEKHM2.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 175.59 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/68ef5cbc-c363-45ed-b967-2d07ff6250ba/ct/PLEKHM2.ct" "/disk1/www/rails/humanrnamap/public/result/68ef5cbc-c363-45ed-b967-2d07ff6250ba/fold_FE/PLEKHM2.txt" -sh "PLEKHM2.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 175.59 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/68ef5cbc-c363-45ed-b967-2d07ff6250ba/ct/PLEKHM2.ct" 1 "/disk1/www/rails/humanrnamap/public/result/68ef5cbc-c363-45ed-b967-2d07ff6250ba/fold_dbn/PLEKHM2_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.59 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAGGGUCACCAAGAAGAAGAAAAUUGGCAAGAAGAAAAAGAGCAGAUCAGAUGAGGAGGCAAGUCCACUCCACCCCGC', '-structureDBN', '..((((..((((...........))))............((.....))......((((.........))))))))...', '-o', '/disk1/www/rails/humanrnamap/public/result/68ef5cbc-c363-45ed-b967-2d07ff6250ba/final_image/PLEKHM2_fold_1.svg', '-title', 'PLEKHM2, -7.5 ± 0.9\n kcal/mol, AUC: 0.569', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '64,3,4,5,6,69,13,77,16,19,24,25,26,27,31,34,40,42,45,47,50,52,53,55,56,58,59,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,66,36,70,7,71,73,74,75,76,78,21,60', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '32,65,2,35,68,37,72,41,43,18,20,54,61,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '67,8,9,10,11,12,14,15,17,22,23,28,29,30,33,38,39,44,46,48,49,51,57']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 153.74666105945846, Y: 268.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 171.24666105945846, Y: 268.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 188.74666105945846, Y: 268.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 188.74666105945846, Y: 248.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 188.74666105945846, Y: 228.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 188.74666105945846, Y: 208.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 172.32407847821435, Y: 203.89373394439178, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 157.14279494608223, Y: 196.00826808785882, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 143.77957885184418, Y: 185.32761281413013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.4172759257458, Y: 196.8287015867026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 111.05497299964745, Y: 208.32979035927514, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 94.6926700735491, Y: 219.8308791318476, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 93.94705011388106, Y: 237.31496287466547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 85.63901703775986, Y: 252.71709648842813, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 71.43763183654286, Y: 262.94303369813065, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.19591373215871, Y: 265.9384118477262, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 37.37767646347185, Y: 261.1014677066104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 24.361657634360988, Y: 249.40393004732698, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 17.762739623289853, Y: 233.19580200818308, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 18.906626906460012, Y: 215.73325192712315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 27.563515675273656, Y: 200.5244580796641, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 41.99426078933953, Y: 190.624825313597, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 59.299765251157964, Y: 188.02316261983668, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 76.00340081811879, Y: 193.24213687693776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.36570374421714, Y: 181.7410481043653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 108.7280066703155, Y: 170.23995933179276, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 125.09030959641387, Y: 158.7388705592203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 119.47614633215775, Y: 142.16385409339807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 117.26205380366792, Y: 124.80448214982576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 118.53605850653321, Y: 107.35091769963171, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 123.24750936456152, Y: 90.49706856026941, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 131.20909148335045, Y: 74.91299944576085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.10427329782684, Y: 61.2182919560222, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 155.49989103475593, Y: 49.957411642029456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 170.86337016508963, Y: 41.578061487524565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 187.58389916650293, Y: 36.41338241589801, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 204.99671378300974, Y: 34.668708483277214, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 222.40952630336682, Y: 36.41340333650953, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 239.13004909966833, Y: 41.578102496999236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 254.49351816262714, Y: 49.95747110993818, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 268.6356537863581, Y: 35.81533548620723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 275.3813610463199, Y: 19.667696606155346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 291.56136814786134, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 307.7252382009561, Y: 19.706721460172048, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 314.43195966112813, Y: 35.870591513266845, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 307.7642630549728, Y: 52.05059861480822, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 291.61662417492084, Y: 58.79630587477004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 277.47448855118984, Y: 72.93844149850096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 285.9195422871391, Y: 88.45792915046925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 291.08508706379524, Y: 105.35439554859593, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 292.76178220868513, Y: 122.94308859196244, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 290.8816773885253, Y: 140.51120276075915, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 285.5209663881711, Y: 157.34676652183788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 276.89689925466877, Y: 172.76749593582826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 265.35897794594166, Y: 186.14844513445712, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 276.1881935081937, Y: 202.9629653567614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 287.01740907044575, Y: 219.77748557906563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 297.8466246326978, Y: 236.59200580136985, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 315.0093262478411, Y: 240.01123807803435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 328.12044265950544, Y: 251.60210096791508, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 333.61841532703517, Y: 268.2160039602683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 330.0097519424137, Y: 285.33987690620904, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 318.2747249320543, Y: 298.32211928410214, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 301.60108615180866, Y: 303.63618043524775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.5181326300181, Y: 299.8385265457297, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 271.66634936466704, Y: 287.96076821376016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 266.53684855506793, Y: 271.22942942881684, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 270.5230292714534, Y: 254.1894810900294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 259.6938137092014, Y: 237.37496086772518, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 248.86459814694933, Y: 220.56044064542095, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 238.0353825846973, Y: 203.74592042311673, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 221.24666105945846, Y: 208.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 221.24666105945846, Y: 228.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 221.24666105945846, Y: 248.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 221.24666105945846, Y: 268.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 238.74666105945846, Y: 268.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 256.24666105945846, Y: 268.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 273.74666105945846, Y: 268.68442521181373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 154.49666105945846, Y: 288.68442521181373, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 135.1683646983183, Y: 213.191004512801, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: -4.0, Y: 209.98663156671194, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 95.08366322462035, Y: 103.91353204258678, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 246.90793786102432, Y: 30.328708445165944, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 306.9526718163059, Y: 101.46204812344718, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 341.064278610401, Y: 240.58775390399038, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 228.30007792464508, Y: 231.38965620767297, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '78', X: 269.99666105945846, Y: 288.68442521181373, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'PLEKHM2, -7.5 ± 0.9
 kcal/mol, AUC: 0.569', X: 109.69057747516251, Y: 321.43618043524776, Width: 142.5, Height: 23
Calculated bounding box: (-4.0, 5.0, 359.064278610401, 321.43618043524776)
Updated viewBox: -9.0 0.0 373.064278610401 326.43618043524776
Updated SVG: /disk1/www/rails/humanrnamap/public/result/68ef5cbc-c363-45ed-b967-2d07ff6250ba/final_image/PLEKHM2_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/68ef5cbc-c363-45ed-b967-2d07ff6250ba/final_image/PLEKHM2_fold_final_1.svg
