Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 16% [=========                                         ] |                     
 21% [===========                                       ] /                     
 27% [==============                                    ] -                     
 32% [=================                                 ] \                     
 38% [====================                              ] |                     
 43% [======================                            ] /                     
 48% [=========================                         ] -                     
 54% [============================                      ] \                     
 59% [==============================                    ] |                     
 65% [=================================                 ] /                     
 70% [====================================              ] -                     
 76% [=======================================           ] \                     
 81% [=========================================         ] |                     
 86% [============================================      ] /                     
 92% [===============================================   ] -                     
 97% [================================================= ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/6a99dbe8-1482-4f11-8770-7ef32bb3f1ec/final_image/TNRC18_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.60 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.60 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.60 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.21 MB
Based on canonical annotations, the following gene is in your area of interest: TNRC18(-)
write fasta - Elapsed time since the previous call: 0.42 seconds
write fasta - Current memory usage: 172.21 MB
Length of region: 92 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.79 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/6a99dbe8-1482-4f11-8770-7ef32bb3f1ec/fasta/TNRC18.fasta" "/disk1/www/rails/humanrnamap/public/result/6a99dbe8-1482-4f11-8770-7ef32bb3f1ec/ct/TNRC18.ct" --SHAPE "TNRC18.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 175.79 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/6a99dbe8-1482-4f11-8770-7ef32bb3f1ec/ct/TNRC18.ct" "/disk1/www/rails/humanrnamap/public/result/6a99dbe8-1482-4f11-8770-7ef32bb3f1ec/fold_FE/TNRC18.txt" -sh "TNRC18.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 175.79 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/6a99dbe8-1482-4f11-8770-7ef32bb3f1ec/ct/TNRC18.ct" 1 "/disk1/www/rails/humanrnamap/public/result/6a99dbe8-1482-4f11-8770-7ef32bb3f1ec/fold_dbn/TNRC18_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.79 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACAGUUUUAUUGUACCAAGAGACUCGCCCCGCCCCUGUAUCAUAAGCCUUUAAAUGGAGUCAACUUUUUAAUUAUAUAUAUAAAGAUAAAUA', '-structureDBN', '(((((...))))).......(((((...............................)))))...............................', '-o', '/disk1/www/rails/humanrnamap/public/result/6a99dbe8-1482-4f11-8770-7ef32bb3f1ec/final_image/TNRC18_fold_1.svg', '-title', 'TNRC18, -5.9 ± 0.4\n kcal/mol, AUC: 0.537', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,5,6,7,8,10,11,12,13,19,21,24,26,31,36,37,38,40,43,46,49,50,51,55,56,57,59,60,65,66,67,68,69,72,73,75,77,79,81,85,87,91', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '64,1,70,9,74,76,14,22,88,90,92,28,33,42,47,52', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,3,34,78,48,80,82,23,27,29', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '71,15,16,17,18,83,20,84,86,25,89,30,32,35,39,41,44,45,53,54,58,61,62,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 273.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 253.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 4.75, Y: 233.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 4.75, Y: 213.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 5.690201138557143, Y: 196.0586499050571, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 21.0, Y: 187.58157194655206, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 36.30979886144286, Y: 196.0586499050571, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 37.25, Y: 213.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 37.25, Y: 233.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 37.25, Y: 253.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 37.25, Y: 273.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 37.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 54.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 72.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 273.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.25, Y: 253.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 233.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.25, Y: 213.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 160.36398612072472, Y: 208.9385916905576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.6154516137333, Y: 201.30751255829654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 130.54500565460918, Y: 190.90211692179622, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 118.63565268968227, Y: 178.07959689656252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.29621205926935, Y: 163.28011864387662, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 102.84728421653483, Y: 147.01171252895762, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 99.51024528780425, Y: 129.8328336648155, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 99.39964776450779, Y: 112.33319149622895, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 102.51928819265822, Y: 95.11350649795503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 108.76207684659073, Y: 78.76488889085857, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 117.91371386074957, Y: 63.84854725486059, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 129.66004562679322, Y: 50.876523593042634, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 143.59784892865963, Y: 40.29411616565568, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.2486726222678, Y: 32.46459347571323, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 176.07526170840185, Y: 27.656724138145307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 193.5, Y: 26.035550702005764, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 210.92473829159815, Y: 27.656724138145307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.75132737773222, Y: 32.46459347571323, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 243.40215107134043, Y: 40.29411616565568, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 257.3399543732068, Y: 50.876523593042634, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 269.08628613925043, Y: 63.84854725486059, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 278.23792315340927, Y: 78.76488889085863, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.4807118073418, Y: 95.11350649795509, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 287.6003522354922, Y: 112.33319149622895, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 287.48975471219575, Y: 129.8328336648155, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.15271578346517, Y: 147.01171252895762, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.70378794073065, Y: 163.28011864387673, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 268.3643473103177, Y: 178.07959689656255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 256.4549943453908, Y: 190.90211692179622, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 242.38454838626672, Y: 201.30751255829654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 226.63601387927525, Y: 208.9385916905576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.75, Y: 213.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 233.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.75, Y: 253.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 209.75, Y: 273.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 209.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 297.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 314.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 384.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 419.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 454.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 489.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 524.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 559.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 577.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 594.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 612.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 629.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 647.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 664.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 682.25, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 699.75, Y: 293.5333977919786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 717.25, Y: 293.53339779197864, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 734.75, Y: 293.53339779197864, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 752.25, Y: 293.53339779197864, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 313.5333977919786, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 53.5, Y: 233.5333977919786, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 156.0, Y: 313.5333977919786, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 87.71645539509882, Y: 172.34101138667336, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 168.63565520406348, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 303.64164388401184, Y: 131.8114208862313, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 226.0, Y: 273.5333977919786, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 363.5, Y: 313.5333977919786, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 538.5, Y: 313.5333977919786, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 713.5, Y: 313.53339779197864, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '92', X: 748.5, Y: 313.53339779197864, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TNRC18, -5.9 ± 0.4
 kcal/mol, AUC: 0.537', X: 312.5, Y: 326.33339779197865, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 766.5, 326.33339779197865)
Updated viewBox: -0.25 -5.0 771.75 336.33339779197865
Updated SVG: /disk1/www/rails/humanrnamap/public/result/6a99dbe8-1482-4f11-8770-7ef32bb3f1ec/final_image/TNRC18_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/6a99dbe8-1482-4f11-8770-7ef32bb3f1ec/final_image/TNRC18_fold_final_1.svg
