Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 16% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 33% [=================                                 ] \                     
 39% [====================                              ] |                     
 44% [=======================                           ] /                     
 50% [==========================                        ] -                     
 56% [=============================                     ] \                     
 61% [===============================                   ] |                     
 67% [==================================                ] /                     
 73% [=====================================             ] -                     
 78% [========================================          ] \                     
 84% [===========================================       ] |                     
 89% [=============================================     ] /                     
 95% [================================================  ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/6a9b77b6-f7c1-4fdf-bede-c0ba6551b98a/final_image/CALD1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.12 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.12 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.12 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.69 MB
Based on canonical annotations, the following gene is in your area of interest: CALD1(+)
write fasta - Elapsed time since the previous call: 0.83 seconds
write fasta - Current memory usage: 171.69 MB
Length of region: 89 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 175.21 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/6a9b77b6-f7c1-4fdf-bede-c0ba6551b98a/fasta/CALD1.fasta" "/disk1/www/rails/humanrnamap/public/result/6a9b77b6-f7c1-4fdf-bede-c0ba6551b98a/ct/CALD1.ct" --SHAPE "CALD1.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 175.21 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/6a9b77b6-f7c1-4fdf-bede-c0ba6551b98a/ct/CALD1.ct" "/disk1/www/rails/humanrnamap/public/result/6a9b77b6-f7c1-4fdf-bede-c0ba6551b98a/fold_FE/CALD1.txt" -sh "CALD1.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 175.21 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/6a9b77b6-f7c1-4fdf-bede-c0ba6551b98a/ct/CALD1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/6a9b77b6-f7c1-4fdf-bede-c0ba6551b98a/fold_dbn/CALD1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 175.21 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CGCCAGAAGAUGCCAGAAGAUGGCUUGUCAGAUGACAAGAAACCAUUCAAGUGUUUCACUCCUAAAGGUUCAUCUCUCAAGAUAGAAGA', '-structureDBN', '.(((.......((((.....)))).((((....)))).((((.(((....))))))).........))).(((((....)))).)....', '-o', '/disk1/www/rails/humanrnamap/public/result/6a9b77b6-f7c1-4fdf-bede-c0ba6551b98a/final_image/CALD1_fold_1.svg', '-title', 'CALD1, -14.2 ± 1.0\n kcal/mol, AUC: 0.898', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,6,9,11,12,16,19,21,22,23,25,26,27,28,31,33,34,39,46,47,51,52,53,54,55,56,60,63,67,68,69,70,73,75,77,81,83,85,88', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '24,35,44', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,3,4,71,72,74,14,15,78,79,89,29,36,37,38,40,41,42,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,65,66,5,7,8,10,76,13,80,17,18,82,20,84,86,87,30,32,43,45,48,49,50,57,58,59,61']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 128.1587761053458, Y: 310.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 145.6587761053458, Y: 310.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 145.6587761053458, Y: 290.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 145.6587761053458, Y: 270.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 128.9695396718369, Y: 265.6255020780127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 113.77259142575718, Y: 256.9478494173974, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 100.7564180719632, Y: 245.2504940361032, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 90.51070789241027, Y: 231.06337612551562, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 83.49963534674728, Y: 215.0292327604412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 80.04083198548756, Y: 197.87447916266404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 80.29099638326468, Y: 180.37629898681735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 84.23879502369701, Y: 163.32743457927074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 67.01436705443936, Y: 153.16283517093916, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 49.789939085181715, Y: 142.99823576260752, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 32.565511115924096, Y: 132.83363635427588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 15.245225369101036, Y: 130.33193503595976, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 116.3283264906795, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 7.20989813991855, Y: 99.00205427248756, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 21.18813969467618, Y: 88.47306710018495, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 38.52029749080191, Y: 90.89114773735662, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 49.08298515446293, Y: 104.84394090423223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 66.30741312372058, Y: 115.00854031256387, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 83.5318410929782, Y: 125.1731397208955, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 100.75626906223584, Y: 135.3377391292271, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 113.77243651756527, Y: 123.6403298102872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 128.96939377538317, Y: 114.96262907195461, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.73657175027654, Y: 95.41568000812958, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 120.50374972516994, Y: 75.8687309443045, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 116.27092770006334, Y: 56.321781880479364, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.17580516359297, Y: 40.32457938163424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 117.10201915233438, Y: 24.722451853592815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 134.20563453299525, Y: 21.018725013367145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 147.87629042314944, Y: 31.944127483280113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 148.0347199287791, Y: 49.44344608968112, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 152.2675419538857, Y: 68.99039515350626, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 156.5003639789923, Y: 88.53734421733134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 160.7331860040989, Y: 108.08429328115642, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.15865123090455, Y: 109.69772491261347, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.84792500092306, Y: 114.96252700095181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 206.32428976177243, Y: 98.58287340644824, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 217.8006545226218, Y: 82.20321981194462, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.2770192834712, Y: 65.823566217441, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 235.95235337474355, Y: 49.646663405183745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 252.6696034749907, Y: 44.4711616021595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 270.0256675838673, Y: 34.5330008745114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 287.38173169274387, Y: 24.594840146863305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 300.48939866918454, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.7567142272553, Y: 15.844479744099715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 326.4526226333122, Y: 31.031066871893017, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 320.1656991236241, Y: 47.36281032995407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 303.531242875172, Y: 52.79844432378769, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 286.17517876629546, Y: 62.73660505143579, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 268.81911465741894, Y: 72.67476577908388, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 255.89395637453953, Y: 84.47265895382122, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.41759161369015, Y: 100.85231254832485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.94122685284077, Y: 117.23196614282847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 221.4648620919914, Y: 133.61161973733203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.1120272704209, Y: 147.50002762532404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 239.57867362350146, Y: 163.32719389847693, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 243.52652893599958, Y: 180.3760776869126, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 243.77673784249032, Y: 197.8742888955793, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 240.31796476913394, Y: 215.029080903267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 233.30690748547624, Y: 231.06326550259323, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 223.06119800009515, Y: 245.25042297479933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 210.04501242102728, Y: 256.94781212671114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.84804171815537, Y: 265.62548931914296, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 178.1587761053458, Y: 270.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 178.1587761053458, Y: 290.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 178.1587761053458, Y: 310.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 195.6587761053458, Y: 310.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 213.1587761053458, Y: 310.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.34317286466785, Y: 293.8112156623776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 200.83168101909865, Y: 275.71274869517816, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 192.32018917352949, Y: 257.6142817279787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 183.8086973279603, Y: 239.51581476077928, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 173.30452927130722, Y: 225.51889706315112, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.5272184566729, Y: 208.53596010747754, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 193.36340941291007, Y: 201.08838952411412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.13720330128746, Y: 208.66722043419352, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 213.2187061496594, Y: 225.68464051172936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 221.73019799522856, Y: 243.7831074789288, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 230.24168984079776, Y: 261.88157444612824, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 238.75318168636693, Y: 279.98004141332774, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.47441059758938, Y: 293.81135554587377, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 245.6587761053458, Y: 310.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.1587761053458, Y: 310.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 280.6587761053458, Y: 310.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 298.1587761053458, Y: 310.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 315.6587761053458, Y: 310.89031726553344, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 128.9087761053458, Y: 330.89031726553344, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 56.376020297397815, Y: 199.7184627384922, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 44.89330272577888, Y: 73.64224153978489, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 85.43271896084352, Y: 39.79874282011582, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 186.19463616726884, Y: 87.10650864559886, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 330.1880497852749, Y: 61.865305192994924, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 259.6304802658127, Y: 177.96348228083795, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 191.9087761053458, Y: 330.89031726553344, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 226.42048650138253, Y: 215.07157578437875, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '89', X: 311.9087761053458, Y: 330.89031726553344, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CALD1, -14.2 ± 1.0
 kcal/mol, AUC: 0.898', X: 99.60131131665611, Y: 343.69031726553345, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 348.1880497852749, 343.69031726553345)
Updated viewBox: -0.25 0.0 353.4380497852749 348.69031726553345
Updated SVG: /disk1/www/rails/humanrnamap/public/result/6a9b77b6-f7c1-4fdf-bede-c0ba6551b98a/final_image/CALD1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/6a9b77b6-f7c1-4fdf-bede-c0ba6551b98a/final_image/CALD1_fold_final_1.svg
