Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 13% [=======                                           ] \                     
 20% [===========                                       ] |                     
 27% [==============                                    ] /                     
 34% [==================                                ] -                     
 41% [=====================                             ] \                     
 47% [========================                          ] |                     
 54% [============================                      ] /                     
 61% [===============================                   ] -                     
 68% [===================================               ] \                     
 75% [======================================            ] |                     
 82% [==========================================        ] /                     
 89% [=============================================     ] -                     
 95% [================================================  ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/6b200b14-1bf1-46bc-8ef9-f0b7e70e39f3/final_image/CLASP1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.20 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.20 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.20 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.79 MB
Based on canonical annotations, the following gene is in your area of interest: CLASP1(-)
write fasta - Elapsed time since the previous call: 0.74 seconds
write fasta - Current memory usage: 170.79 MB
Length of region: 73 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 173.97 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/6b200b14-1bf1-46bc-8ef9-f0b7e70e39f3/fasta/CLASP1.fasta" "/disk1/www/rails/humanrnamap/public/result/6b200b14-1bf1-46bc-8ef9-f0b7e70e39f3/ct/CLASP1.ct" --SHAPE "CLASP1.dat"

fold - Elapsed time since the previous call: 0.07 seconds
fold - Current memory usage: 173.97 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/6b200b14-1bf1-46bc-8ef9-f0b7e70e39f3/ct/CLASP1.ct" "/disk1/www/rails/humanrnamap/public/result/6b200b14-1bf1-46bc-8ef9-f0b7e70e39f3/fold_FE/CLASP1.txt" -sh "CLASP1.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 173.97 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/6b200b14-1bf1-46bc-8ef9-f0b7e70e39f3/ct/CLASP1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/6b200b14-1bf1-46bc-8ef9-f0b7e70e39f3/fold_dbn/CLASP1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 173.97 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGCUACUAAACUUAUACAUAAAGAGGGCCCAGACCACCAACAGCAACAGCAGCUCCUCCUCCGAUGUCUCCAC', '-structureDBN', '......................((((((.......................)).))))...............', '-o', '/disk1/www/rails/humanrnamap/public/result/6b200b14-1bf1-46bc-8ef9-f0b7e70e39f3/final_image/CLASP1_fold_1.svg', '-title', 'CLASP1, -6.9 ± 0.5\n kcal/mol, AUC: 0.879', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '65,2,66,4,67,69,7,12,13,15,19,23,25,26,27,32,43,49,52,54,57,60,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '68,39,72,14,53,55,24,59,28', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,5,70,71,8,9,10,18,20,31,35,38,44,50,56,58,61,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,3,6,73,11,16,17,21,22,29,30,33,34,36,37,40,41,42,45,46,47,48,51']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 257.23536049714784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 257.23536049714784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 257.23536049714784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 257.23536049714784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 257.23536049714784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 257.23536049714784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 257.23536049714784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 354.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 372.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 389.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 389.75, Y: 237.23536049714787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 389.75, Y: 217.23536049714787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 389.75, Y: 197.23536049714787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 385.93439675932206, Y: 180.15625889399203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 377.42290491375286, Y: 162.0577919267926, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 359.9956900439684, Y: 163.65199676018565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 342.6965931702251, Y: 161.00803107937648, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 326.541165566933, Y: 154.28111008064033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 312.4778188888105, Y: 143.86614069137235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 301.3321482374788, Y: 130.37453838102775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 293.7584652291296, Y: 114.5983337405734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 290.2013863363593, Y: 97.46367596987201, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 290.8697314778661, Y: 79.97646287171725, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 295.7242651510595, Y: 63.16328916821081, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 304.4799997699136, Y: 48.01117979516809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 316.6229259895783, Y: 35.40964615865255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 331.44018785650564, Y: 26.098466967199442, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 348.06193133831215, Y: 20.62425918949532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 365.5123694965773, Y: 19.308388659005686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 382.76706649861137, Y: 22.228104147961176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 398.8130775844731, Y: 29.212002443387178, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 412.70841444538684, Y: 39.85009064992974, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 423.63734507173115, Y: 53.51785500746118, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 430.9582816681125, Y: 69.41292325268157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 434.2414453538997, Y: 86.60216824426803, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 433.29409652600634, Y: 104.0764876120356, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 428.1718497241105, Y: 120.81004356613326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.17540875405075, Y: 135.8204851665887, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 406.83291373545194, Y: 148.22661767774267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 415.34440558102114, Y: 166.3250846449421, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 426.0656344922436, Y: 180.1563987774882, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 422.25, Y: 197.23536049714787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 422.25, Y: 217.23536049714787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 422.25, Y: 237.23536049714787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 422.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 439.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 457.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 474.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 492.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 509.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 527.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 544.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 562.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 579.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 597.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 614.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 632.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 649.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 667.25, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 684.75, Y: 257.2353604971479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 277.23536049714784, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 277.2353604971479, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 277.2353604971479, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 333.55206235915574, Y: 180.26677032493518, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 319.17869601093645, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 442.6958913095602, Y: 128.93773722013214, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 453.5, Y: 277.2353604971479, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 628.5, Y: 277.2353604971479, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '73', X: 681.0, Y: 277.2353604971479, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLASP1, -6.9 ± 0.5
 kcal/mol, AUC: 0.879', X: 278.75, Y: 290.0353604971479, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 699.0, 290.0353604971479)
Updated viewBox: -0.25 -5.0 704.25 300.0353604971479
Updated SVG: /disk1/www/rails/humanrnamap/public/result/6b200b14-1bf1-46bc-8ef9-f0b7e70e39f3/final_image/CLASP1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/6b200b14-1bf1-46bc-8ef9-f0b7e70e39f3/final_image/CLASP1_fold_final_1.svg
