Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 39% [====================                              ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 56% [=============================                     ] \                     
 62% [================================                  ] |                     
 68% [===================================               ] /                     
 73% [=====================================             ] -                     
 79% [========================================          ] \                     
 85% [===========================================       ] |                     
 90% [==============================================    ] /                     
 96% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/6b49fe7f-0307-400a-8eab-1854ad5ae22f/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.92 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.92 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.92 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.64 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.33 seconds
write fasta - Current memory usage: 172.64 MB
Length of region: 88 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.21 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/6b49fe7f-0307-400a-8eab-1854ad5ae22f/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/6b49fe7f-0307-400a-8eab-1854ad5ae22f/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.21 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/6b49fe7f-0307-400a-8eab-1854ad5ae22f/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/6b49fe7f-0307-400a-8eab-1854ad5ae22f/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 176.21 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/6b49fe7f-0307-400a-8eab-1854ad5ae22f/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/6b49fe7f-0307-400a-8eab-1854ad5ae22f/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.21 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCAAGAUUCUGGGUCAGAUAAUCGUAUAAACACAGUCAGUCUCAAGGAAGCAUUGGAAAGGUUUGAUCACAGCCCAACCCCUUCUGCC', '-structureDBN', '((((..(((((((...(((...............)))...)))..))))...))))...(((.((....)))))..............', '-o', '/disk1/www/rails/humanrnamap/public/result/6b49fe7f-0307-400a-8eab-1854ad5ae22f/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -13.9 ± 0.9\n kcal/mol, AUC: 0.85', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,7,8,10,11,12,13,14,17,19,22,24,25,27,35,36,39,40,42,46,47,50,53,54,55,56,60,61,62,63,64,65,67,72,82,83,85,86', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,2,3,4,70,9,41,73,74,81,84,87,88', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '34,37,71,43,75,77,15,16,48,49,20,21,57', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '66,68,69,6,76,78,79,80,18,23,26,28,29,30,31,32,33,38,44,45,51,52,58,59']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 244.40045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 244.40045362348997, Y: 338.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.40045362348997, Y: 318.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.40045362348997, Y: 298.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 232.81930120194033, Y: 285.3456329360638, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 230.29692852778658, Y: 268.028411582611, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 237.654344309181, Y: 252.1502204913221, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 231.94911039884164, Y: 232.98122714194892, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 226.24387648850234, Y: 213.81223379257568, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 220.53864257816304, Y: 194.6432404432025, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.52352765468498, Y: 181.04500364756706, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 191.95665185570755, Y: 171.48441398670923, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 174.3897760567301, Y: 161.9238243258514, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 157.66102925529856, Y: 167.0618515020609, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 140.63367329051175, Y: 163.0221186323883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.99588086963712, Y: 150.91689267263212, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 123.22723823202853, Y: 134.07912737540056, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 105.66036740364842, Y: 124.51852858144383, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 88.09349657526832, Y: 114.95792978748705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 73.32357681487008, Y: 124.34409368127706, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 56.225477276679044, Y: 128.07311427009148, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 38.88857834577982, Y: 125.68930684719174, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 23.431441589994506, Y: 117.48397165095258, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 11.742922450535957, Y: 104.45979710143894, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 5.251352922203637, Y: 88.20833170817309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 70.71549752908459, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 10.300128794665284, Y: 54.118911352032455, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 21.223515962583747, Y: 40.44666884579226, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 36.185328305694384, Y: 31.36951214453211, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 53.35723881226187, Y: 27.996665880006276, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 70.64084742871842, Y: 30.740290410228113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 85.92410464066995, Y: 39.26511600158324, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 97.33940301212454, Y: 52.52941264559547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 103.49179800822742, Y: 68.91228901641682, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 103.62946961544799, Y: 86.41176469136929, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 121.19634044382815, Y: 95.97236348532601, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 138.7632112722083, Y: 105.53296227928286, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 155.49195207981302, Y: 100.39494408235316, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 172.51929937949114, Y: 104.43467723395412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 185.15708733217582, Y: 116.53989576411624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 189.92573425562404, Y: 133.37765115251312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 207.49261005460147, Y: 142.9382408133709, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 225.0594858535789, Y: 152.49883047422867, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 242.45966429392104, Y: 154.36532190047558, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 253.47487272158224, Y: 167.9636741276824, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 251.6882567708945, Y: 185.37223533890108, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 257.3934906812338, Y: 204.54122868827432, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.0987245915731, Y: 223.7102220376475, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 268.8039585019124, Y: 242.87921538702074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 283.6464753059168, Y: 252.1501212177822, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 291.00396599517114, Y: 268.028324225602, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 288.48162460242486, Y: 285.3455928872137, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 276.90045362348997, Y: 298.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 276.90045362348997, Y: 318.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 276.90045362348997, Y: 338.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 276.90045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 294.40045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 311.90045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 329.40045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 346.90045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 346.90045362348997, Y: 338.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 346.90045362348997, Y: 318.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 343.0848347569073, Y: 301.38625934565465, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 353.8061757160467, Y: 287.5549500126523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 362.3177937312945, Y: 269.4565423820758, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 366.39941521314796, Y: 252.43915075834389, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 382.17326193546387, Y: 244.86042981233516, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 398.00940097204983, Y: 252.30811079439292, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 402.23197176412447, Y: 269.2910771872969, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 391.72770613098135, Y: 283.2879216568534, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 383.21608811573356, Y: 301.38632928742993, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 379.40045362348997, Y: 318.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 379.40045362348997, Y: 338.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 379.40045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 396.90045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 414.40045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 431.90045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 449.40045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 466.90045362348997, Y: 358.4652910070896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 484.40045362348997, Y: 358.46529100708966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 501.90045362348997, Y: 358.46529100708966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 519.40045362349, Y: 358.46529100708966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 536.90045362349, Y: 358.46529100708966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 554.40045362349, Y: 358.46529100708966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 571.90045362349, Y: 358.46529100708966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 589.40045362349, Y: 358.46529100708966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 606.90045362349, Y: 358.46529100708966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 624.40045362349, Y: 358.46529100708966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 245.15045362348997, Y: 378.4652910070896, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 197.61964922878983, Y: 200.3484743535418, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 77.18512842484226, Y: 142.83907359715505, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 49.242062576188104, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 198.54631666058265, Y: 106.23228604952772, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 294.89038744535384, Y: 238.91446487762127, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 329.008317999759, Y: 372.60742663082056, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 407.9767316438062, Y: 283.0904918278483, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 480.65045362348997, Y: 378.46529100708966, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '88', X: 620.65045362349, Y: 378.46529100708966, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -13.9 ± 0.9
 kcal/mol, AUC: 0.85', X: 253.07522681174498, Y: 391.2652910070897, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 0.0, 638.65045362349, 391.2652910070897)
Updated viewBox: -0.25 -5.0 643.90045362349 401.2652910070897
Updated SVG: /disk1/www/rails/humanrnamap/public/result/6b49fe7f-0307-400a-8eab-1854ad5ae22f/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/6b49fe7f-0307-400a-8eab-1854ad5ae22f/final_image/CLOCK_fold_final_1.svg
